Order Kazusa clone(s) from : ![]() |
Product ID | ORK01988 |
---|---|
Accession No | AB014556 |
Description | synaptosomal-associated protein, 91kDa, transcript variant 1 |
Clone name | hk01789 |
Vector information | |
cDNA sequence | DNA sequence (4369 bp) Predicted protein sequence (912 aa) |
HaloTag ORF Clone |
FHC01988
![]() |
Flexi ORF Clone | FXC01988 |
Source | Human adult brain |
Rouge ID |
mKIAA0656
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1402 bp |
---|---|
Genome contig ID | gi89161210r_84219332 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | r | 84319332 | 84475495 | 28 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
---|
![]() |
Primer_f | TCTTCCATCCTTCAACTGAGC |
---|---|
Primer_r | CAGCACAGACAGTATGACAAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TCTTCCATCCTTCAACTGAGC |
Primer_r | CAGCACAGACAGTATGACAAC |
PCR product length | 140 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |