KIAA0614

Product ID	ORK01104
Accession No	AB014514
Description	HECT domain containing E3 ubiquitin protein ligase 4
Clone name	hg01176s2
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (11211 bp) Predicted protein sequence (3006 aa)
Flexi ORF Clone	FXC01104
Source	Human adult brain
Rouge ID	mKIAA0614 by Kazusa Mouse cDNA Project
Note	We replaced hg01176 and hg01176s1, former representative clones for KIAA0614 with hg01176s2. (2002/5/10,2003/8/28)

Length: 11211 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2190 bp
Genome contig ID	gi89161190r_110982384
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- CTGCCAAGTGGCTAGGAATTAAAGTGTTTCTAATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTATGGTCTCTTGGCATTTGACGTGATTCTTACTCCATGAGGTTTTTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	111082384	111169738	49	100.0	Terminal No-hit

Length: 3006 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW97998	100.0	chromosome 12 o...	Homo sapiens
NP_001103132	100.0	chromosome 12 o...	Homo sapiens
XP_001109970	99.4	similar to hect...	Macaca mulatta
XP_001490551	97.7	similar to chro...	Equus caballus
XP_222205	96.9	similar to hect...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037741	1.1e-06	26.9	KIAA1320
D28476	0.00013	25.8	KIAA0045
AB046845	0.0002	23.9	KIAA1625
AB002310	0.00066	22.7	KIAA0312
D13635	0.00094	23.5	KIAA0010

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000569	2681	3004	PF00632	HECT
HMMSmart	IPR000569	2635	3000	SM00119	HECT
ProfileScan	IPR000569	2647	3006	PS50237	HECT

Primer_f	TTTGGAGTGTGGATGCTGGTC
Primer_r	TTACAGGGAGGAGATGGATGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AAATATCAGAGCCATCCAAGC
Primer_r	GTAAAGGAAGCTCACTAAAGG
PCR product length	140 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles