KIAA0585

Product ID	ORK00568
Accession No	AB011157
Description	jumonji domain containing 6, transcript variant 1
Clone name	hj00998
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5100 bp) Predicted protein sequence (416 aa)
HaloTag ORF Clone	FHC00568
Flexi ORF Clone	FXC00568
Source	Human adult brain
Rouge ID	mKIAA0585 by Kazusa Mouse cDNA Project

Length: 5100 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3849 bp
Genome contig ID	gi51511734r_72120514
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTGTTCATCATTTTAAATAAAGCAACATGATTTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTTGTGTTTTTGGCATTGTTTTGTCCTTATTTTCTTTCTTACTCATTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	72220514	72234158	7	99.2	Perfect prediction

Length: 416 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW89434	1.2e-167	100.0	phosphatidylser...	Homo sapiens
AAH47003	3.6e-163	100.0	Jumonji domain ...	Homo sapiens
Q5R6G2	2.4e-162	100.0	Histone arginin...	Pongo abelii
BAG51050	5e-162	99.8	unnamed protein...	Homo sapiens
XP_849080	2e-160	98.3	similar to Prot...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013129	176	290	PF02373	Transcription factor jumonji
HMMSmart	IPR003347	143	307	SM00558	Transcription factor jumonji/aspartyl beta-hydroxylase
ProfileScan	IPR003347	143	307	PS51184	Transcription factor jumonji/aspartyl beta-hydroxylase

Primer_f	TCTAAGCCCCAGTGAACCTCC
Primer_r	TACCAACCCAATAGCAGATCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	TCTAAGCCCCAGTGAACCTCC
Primer_r	TACCAACCCAATAGCAGATCC
PCR product length	205 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles