KIAA0526

Gene/Protein Characteristic Table for KIAA0526

Order Kazusa clone(s) from :

Product ID	ORK00552
Accession No	AB011098
Description	serine palmitoyltransferase, long chain base subunit 2
Clone name	hg02163
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6814 bp) Predicted protein sequence (609 aa)
HaloTag ORF Clone	FHC00552
Flexi ORF Clone	FXC00552
Source	Human adult brain
Rouge ID	mKIAA0526 by Kazusa Mouse cDNA Project

Length: 6814 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4937 bp
Genome contig ID	gi51511730r_76943726
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTTGGCGACAGAGGGAGACTCTGTCTC
Flanking genome sequence (99719 - 99670)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAGGTGTGCCCAGGCCCCTAGCCATTGCCATGTGCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	77043445	77152863	12	99.2	Perfect prediction

Features of the protein sequence

Description

Length: 609 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_510095	99.5	serine palmitoy...	Pan troglodytes
XP_537524	94.2	similar to seri...	Canis lupus fam...
O15270	100.0	Serine palmitoy...	Homo sapiens
XP_001096042	97.7	similar to seri...	Macaca mulatta
P97363	96.1	Serine palmitoy...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004839	215	575	PF00155	Aminotransferase
ScanRegExp	IPR001917	423	432	PS00599	Aminotransferase

Expression profile

Description

RT-PCR

Experimental conditions

Primer_f	CTACTTGCTTCACGTGGATGC
Primer_r	TGTGGATAAAGTTGAGGCGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 14

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CTACTTGCTTCACGTGGATGC
Primer_r	TGTGGATAAAGTTGAGGCGAG
PCR product length	119 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp