Order Kazusa clone(s) from : ![]() |
Product ID | ORK04237 |
---|---|
Accession No | AB007902 |
Description | autism susceptibility candidate 2 |
Clone name | hh03913 |
Vector information | |
cDNA sequence | DNA sequence (5495 bp) Predicted protein sequence (1266 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0442
by Kazusa Mouse cDNA Project
|
Note | We replaced hh00712, former representative clones for KIAA0442 with hh03913. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1491 bp |
---|---|
Genome contig ID | gi89161213f_68602280 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (1293131 - 1293180) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | f | 68702280 | 69895409 | 16 | 100.0 | Internal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | NULL | 659 | 865 | PD360677 | NULL |
![]() |
---|
![]() |
Primer_f | GGAAGAAGAAACCCTAGGCAG |
---|---|
Primer_r | ATGACTGGGCTAAAAGATCTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CATTACACAAGAAGGCTCCGC |
Primer_r | GTTCTATACGGACCTTTTTGC |
PCR product length | 128 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |