KIAA0391

Product ID	ORK01081
Accession No	AB002389
Description	KIAA0391, transcript variant 2
Clone name	hj00118
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5677 bp) Predicted protein sequence (571 aa)
HaloTag ORF Clone	FHC01081
Flexi ORF Clone	FXC01081
Source	Human adult brain
Rouge ID	mKIAA0391 by Kazusa Mouse cDNA Project

Length: 5677 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	3614 bp
Genome contig ID	gi51511730f_34561528
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- ACACAGATGAATAAATGTAATAAAATTTGAGAAAT
Flanking genome sequence (255045 - 255094)	----+--------+--------+--------+--------+----* AATCTTTACTTTTATCATCTCCATTTATGCTTTTTCATGATGTCCTGACG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	34661528	34816571	8	99.3	Perfect prediction

Length: 571 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG64973	0	99.8	unnamed protein...	Homo sapiens
XP_001084913	1.9e-201	90.3	hypothetical pr...	Macaca mulatta
XP_001084800	6.5e-124	86.8	similar to CG15...	Macaca mulatta
Q4R366	1.4e-123	86.8	Mitochondrial r...	Macaca fascicularis
BAG63351	1.6e-102	96.5	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	ATTTCTATGGCTTCCCCTCTG
Primer_r	TGAGCAGAAAGGAAATAGGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 14

Experimental conditions

Panel name	GeneBridge 4
Primer_f	ATTTCTATGGCTTCCCCTCTG
Primer_r	TGAGCAGAAAGGAAATAGGAC
PCR product length	131 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles