Order Kazusa clone(s) from : ![]() |
Product ID | ORK00481 |
---|---|
Accession No | D87447 |
Description | RGP1 homolog, RAB6A GEF complex partner 1 |
Clone name | ha07053 |
Vector information | |
cDNA sequence | DNA sequence (6313 bp) Predicted protein sequence (410 aa) |
HaloTag ORF Clone |
FHC00481
![]() |
Flexi ORF Clone | FXC00481 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0258
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 5052 bp |
---|---|
Genome contig ID | gi89161216f_35639340 |
PolyA signal sequence (AATAAA,-11) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (108584 - 108633) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | f | 35739340 | 35747922 | 9 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | TTAGGAGTAGGGGGAGTTATG |
Primer_r | GCAGACAGTAATCCAAGACGC |
PCR product length | 136 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |