KIAA0253

Product ID	ORK00480
Accession No	D87442
Description	nicastrin, transcript variant 1
Clone name	ha07036
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2805 bp) Predicted protein sequence (708 aa)
HaloTag ORF Clone	FHC00480
Flexi ORF Clone	FXC00480
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0253 by Kazusa Mouse cDNA Project

Length: 2805 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	677 bp
Genome contig ID	gi89161185f_158479813
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- TATATAATGAGTTTCATTAAAATAGATTATCCCAC
Flanking genome sequence (115551 - 115600)	----+--------+--------+--------+--------+----* ACGACTTGTACTGCTAGTTATTCTTCCCAGGCCACCTTGTTCAGCGAGCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	158579813	158595362	17	100.0	Perfect prediction

Length: 708 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92542	100.0	Nicastrin; Flag...	Homo sapiens
XP_001171763	99.7	nicastrin isofo...	Pan troglodytes
CAH91298	99.2	hypothetical pr...	Pongo abelii
BAE00862	98.9	unnamed protein...	Macaca fascicularis
CAH91017	98.7	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008710	273	498	PF05450	Nicastrin
ScanRegExp	IPR001680	276	290	PS00678	WD40 repeat

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GACTGGGAAGGACATAAAAGG
Primer_r	AGAAAGGACAGTGGGAAGGAG
PCR product length	109 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles