KIAA0177

Product ID	ORK01659
Accession No	D79999
Description	poly (ADP-ribose) polymerase family, member 4
Clone name	ha02779s1
Vector information	The cDNA fragment was originally inserted at Apa I (blunt en ... The cDNA fragment was originally inserted at Apa I (blunt ended)-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: GGTACCGGGC CGCGGGAATT CGATT-5' end of cDNA.
cDNA sequence	DNA sequence (5367 bp) Predicted protein sequence (1725 aa)
Flexi ORF Clone	FXC01659
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0177 by Kazusa Mouse cDNA Project
Note	We replaced ha02779, former representative clones for KIAA0177 with ha02779s1. (2002/12/27)

Length: 5367 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	187 bp
Genome contig ID	gi51511729r_23793070
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CAACTAACAAGCAATAATAAAATGAAACTTAAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTCAGTTTTCTGTGTCTCATTTTTTTTGTTGATTTTTTTATGTATTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	r	23893070	23975919	33	99.3	Perfect prediction
Ensembl gnome browser	13	f	24405137	24409126	2	97.0	Internal No-hit

Length: 1725 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10299	100.0	poly [ADP-ribos...	synthetic construct
AAC62491	99.9	putative poly(A...	Homo sapiens
Q9UKK3	99.7	Poly [ADP-ribos...	Homo sapiens
AAD47250	99.4	vault protein; ...	Homo sapiens
EAX08336	99.4	poly (ADP-ribos...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001357	2	82	PF00533	BRCT
	IPR001290	379	567	PF00644	Poly(ADP-ribose) polymerase
	IPR013694	620	737	PF08487	Vault protein inter-alpha-trypsin
	IPR002035	877	1044	PF00092	von Willebrand factor
HMMSmart	IPR001357	4	85	SM00292	BRCT
	IPR006587	608	736	SM00609	Vault protein inter-alpha-trypsin
	IPR002035	875	1038	SM00327	von Willebrand factor
ProfileScan	IPR001357	2	95	PS50172	BRCT
	IPR004102	243	371	PS51060	Poly(ADP-ribose) polymerase
	IPR012317	370	574	PS51059	PARP
	IPR002035	877	1047	PS50234	von Willebrand factor

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	ATAAGCCCCTGGACATCACAC
Primer_r	TGTCTTCCTCCTCTGTGGCAC
PCR product length	102 (1.4k) bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles