KIAA0120

Product ID	ORK00415
Accession No	D21261
Description	transgelin 2, transcript variant 2
Clone name	ha01756
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (1360 bp) Predicted protein sequence (219 aa)
HaloTag ORF Clone	FHC00415
Flexi ORF Clone	FXC00415
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0120 by Kazusa Mouse cDNA Project

Length: 1360 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	687 bp
Genome contig ID	gi89161185r_158054527
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GTTTGTTGATTTAAATAAAGAATTTGTCATTTTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGGACTCTGGCTGTGTCTGGGGCCACTGTGCCACTGTGGGGAAGGGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	158154527	158161908	5	99.3	Perfect prediction

Length: 219 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_852741	2.2e-84	98.6	similar to tran...	Canis lupus fam...
P37802	1.9e-81	100.0	Transgelin-2; S...	Homo sapiens
AAV38421	1.9e-81	100.0	transgelin 2 [s...	synthetic construct
AAH02616	5.5e-81	99.5	Transgelin 2 [H...	Homo sapiens
Q5E9F5	1.6e-80	99.0	Transgelin-2.	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR003247	79	123	PD001527	Calponin-like actin-binding subtype
FPrintScan	IPR003096	23	37	PR00888	SM22/calponin
	IPR003096	42	55	PR00888	SM22/calponin
	IPR001061	54	73	PR00890	Transgelin (SM22-alpha)
	IPR003096	72	87	PR00888	SM22/calponin
	IPR001061	82	97	PR00890	Transgelin (SM22-alpha)
	IPR001061	104	117	PR00890	Transgelin (SM22-alpha)
	IPR003096	108	124	PR00888	SM22/calponin
	IPR003096	124	139	PR00888	SM22/calponin
	IPR001061	138	147	PR00890	Transgelin (SM22-alpha)
	IPR003096	145	159	PR00888	SM22/calponin
	IPR001061	155	174	PR00890	Transgelin (SM22-alpha)
	IPR001061	181	193	PR00890	Transgelin (SM22-alpha)
	IPR003096	182	195	PR00888	SM22/calponin
	IPR003096	195	210	PR00888	SM22/calponin
HMMPfam	IPR001715	45	157	PF00307	Calponin-like actin-binding
HMMPfam	IPR000557	194	219	PF00402	Calponin repeat
HMMSmart	IPR001715	46	152	SM00033	Calponin-like actin-binding
ProfileScan	IPR001715	44	156	PS50021	Calponin-like actin-binding
ProfileScan	IPR000557	194	219	PS51122	Calponin repeat
ScanRegExp	IPR000557	194	213	PS01052	Calponin repeat

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	CTCTGCCTTCTGATGCTGGAC
Primer_r	GAAAATGAGAAGCCACGAGGG
PCR product length	233 (0.8k) bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles