KIAA0088

Product ID	ORK00404
Accession No	D42041
Description	glucosidase, alpha; neutral AB, transcript variant 6
Clone name	ha01225
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3820 bp) Predicted protein sequence (943 aa)
HaloTag ORF Clone	FHC00404
Flexi ORF Clone	FXC00404
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0088 by Kazusa Mouse cDNA Project

Length: 3820 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	987 bp
Genome contig ID	gi51511727r_62048876
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TCAAAGGAGAAACAATAAAGGGATAAACCATAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTGGTGGTAGTCTGGATTCTAGTTCTAGCCTGAGCCACAGACCCTAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	62148876	62170645	24	99.9	Perfect prediction

Length: 943 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAA04006	100.0	Glucosidase II ...	Homo sapiens
Q14697	99.9	Neutral alpha-g...	Homo sapiens
EAW74050	99.7	glucosidase, al...	Homo sapiens
XP_001154003	99.5	alpha glucosida...	Pan troglodytes
BAG58692	99.7	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032987	2.6e-09	26.0	KIAA1161

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000322	364	809	PF01055	Glycoside hydrolase
ScanRegExp	IPR000322	537	544	PS00129	Glycoside hydrolase
ScanRegExp	IPR000322	644	674	PS00707	Glycoside hydrolase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	15	ASLVLAFLGVCLGITLAVDRS	35	PRIMARY	21
SOSUI2	2	625	LKISIPMCLSLGLVGLSFCGADV	647	PRIMARY	23

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TTACTCCCCTTTTTATGCCCC
Primer_r	ACAAGAAGGGGGCAAAAGAAG
PCR product length	251 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles