Order Kazusa clone(s) from : ![]() |
Product ID | ORK06434 |
---|---|
Accession No | D31765 |
Description | processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae) |
Clone name | ha01242 |
Vector information | |
cDNA sequence | DNA sequence (4276 bp) Predicted protein sequence (903 aa) |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0061
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1562 bp |
---|---|
Genome contig ID | gi51511724f_99109820 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (131420 - 131469) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 8 | f | 99209820 | 99241238 | 13 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Stanford G3 |
---|---|
Primer_f | CTTTCCCTGTCCTTGCTGTAA |
Primer_r | GTCTTCTCTTGTCTTCTGCTA |
PCR product length | 235 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |