Order Kazusa clone(s) from : ![]() |
Product ID | ORK00005 |
---|---|
Accession No | D21852 |
Description | R3H domain containing 1, transcript variant 3 |
Clone name | ha00566 |
Vector information | |
cDNA sequence | DNA sequence (4272 bp) Predicted protein sequence (974 aa) |
HaloTag ORF Clone |
FHC00005
![]() |
Flexi ORF Clone | FXC00005 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0029
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 974 bp |
---|---|
Genome contig ID | gi89161199f_135905541 |
PolyA signal sequence (AATAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (293767 - 293816) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 136005541 | 136199306 | 23 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | GCCACATTCCCCTCCATTTC |
Primer_r | AGGGCAGGGGAACCATAAAG |
PCR product length | 174 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |