KIAA0023

Product ID	ORK00369
Accession No	D14689
Description	nucleoporin 214kDa
Clone name	ha00512
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6642 bp) Predicted protein sequence (2111 aa)
HaloTag ORF Clone	FHC00369
Flexi ORF Clone	FXC00369
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0023 by Kazusa Mouse cDNA Project

Length: 6642 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	305 bp
Genome contig ID	gi89161216f_132890858
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- GTTTTCCCTCCCACTATTAAACAGTCTGTTTCCGT
Flanking genome sequence (208053 - 208102)	----+--------+--------+--------+--------+----* ACAGAACGTATGTGGGTTTTTTCAGATCACAGCCAAGAAGATTGCCCCGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	132990858	133098909	37	100.0	Perfect prediction

Length: 2111 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_238325	75.2	similar to nucl...	Rattus norvegicus
EAW87963	99.5	nucleoporin 214...	Homo sapiens
XP_001167010	98.3	nucleoporin 214...	Pan troglodytes
XP_001166949	98.4	nucleoporin 214...	Pan troglodytes
EAW87960	99.8	nucleoporin 214...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014518	1.4e-06	26.2	KIAA0618

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR001680	156	196	SM00320	WD40 repeat
HMMSmart	IPR001680	200	238	SM00320	WD40 repeat

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TACCCCCTCCCTGCCTATGT
Primer_r	GGCTGACTGTTGCTCCTCTA
PCR product length	130 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles