| 
Order Kazusa clone(s) from :  | 
| Product ID | ORK05492 | 
|---|---|
| Accession No | AK024435 | 
| Clone name | as00025 | 
| Vector information | |
| cDNA sequence | DNA sequence (4559 bp) Predicted protein sequence (955 aa)  | 
| Source | Human spleen | 
| Rouge ID | 
    mFLJ00025
    
    by Kazusa Mouse cDNA Project
     | 
 Length: 4559 bp
 Physical map
    
 Restriction map
 Prediction of protein coding region (GeneMark analysis).
    | N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | Warning | 
 
        Length: 955 aa
        Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
        Result of homology search against other entries from Kazusa human cDNA project
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
	Result of motif / domain search (InterProScan and SOSUI)
 Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition | 
|---|---|---|---|---|---|
| BlastProDom | IPR001680 | 43 | 74 | PD000018 | G-protein beta WD-40 repeat | 
| HMMPfam | IPR001680 | 38 | 75 | PF00400 | G-protein beta WD-40 repeat | 
| IPR001680 | 77 | 114 | PF00400 | G-protein beta WD-40 repeat | |
| IPR001680 | 118 | 154 | PF00400 | G-protein beta WD-40 repeat | |
| IPR001680 | 161 | 202 | PF00400 | G-protein beta WD-40 repeat | |
| IPR001680 | 247 | 284 | PF00400 | G-protein beta WD-40 repeat | |
| IPR001680 | 440 | 477 | PF00400 | G-protein beta WD-40 repeat | |
| HMMSmart | IPR001680 | 36 | 75 | SM00320 | G-protein beta WD-40 repeat | 
| IPR001680 | 77 | 114 | SM00320 | G-protein beta WD-40 repeat | |
| IPR001680 | 116 | 154 | SM00320 | G-protein beta WD-40 repeat | |
| IPR001680 | 156 | 202 | SM00320 | G-protein beta WD-40 repeat | |
| IPR001680 | 204 | 243 | SM00320 | G-protein beta WD-40 repeat | |
| IPR001680 | 245 | 284 | SM00320 | G-protein beta WD-40 repeat | |
| IPR001680 | 442 | 477 | SM00320 | G-protein beta WD-40 repeat | |
| ProfileScan | IPR001680 | 43 | 74 | PS50082 | G-protein beta WD-40 repeat | 
| IPR001680 | 43 | 84 | PS50294 | G-protein beta WD-40 repeat | 
           
	  RT-PCR-ELISA
	   | 
          
	  
 Experimental conditions| Primer_f | CAGAGAACGATCGCTTTGAGG | 
|---|---|
| Primer_r | CTATATCGAGGCACTGCATGG | 
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]()  |