Order Kazusa clone(s) from : ![]() |
Product ID | ORK05492 |
---|---|
Accession No | AK024435 |
Clone name | as00025 |
Vector information | |
cDNA sequence | DNA sequence (4559 bp) Predicted protein sequence (955 aa) |
Source | Human spleen |
Rouge ID |
mFLJ00025
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001680 | 43 | 74 | PD000018 | G-protein beta WD-40 repeat |
HMMPfam | IPR001680 | 38 | 75 | PF00400 | G-protein beta WD-40 repeat |
IPR001680 | 77 | 114 | PF00400 | G-protein beta WD-40 repeat | |
IPR001680 | 118 | 154 | PF00400 | G-protein beta WD-40 repeat | |
IPR001680 | 161 | 202 | PF00400 | G-protein beta WD-40 repeat | |
IPR001680 | 247 | 284 | PF00400 | G-protein beta WD-40 repeat | |
IPR001680 | 440 | 477 | PF00400 | G-protein beta WD-40 repeat | |
HMMSmart | IPR001680 | 36 | 75 | SM00320 | G-protein beta WD-40 repeat |
IPR001680 | 77 | 114 | SM00320 | G-protein beta WD-40 repeat | |
IPR001680 | 116 | 154 | SM00320 | G-protein beta WD-40 repeat | |
IPR001680 | 156 | 202 | SM00320 | G-protein beta WD-40 repeat | |
IPR001680 | 204 | 243 | SM00320 | G-protein beta WD-40 repeat | |
IPR001680 | 245 | 284 | SM00320 | G-protein beta WD-40 repeat | |
IPR001680 | 442 | 477 | SM00320 | G-protein beta WD-40 repeat | |
ProfileScan | IPR001680 | 43 | 74 | PS50082 | G-protein beta WD-40 repeat |
IPR001680 | 43 | 84 | PS50294 | G-protein beta WD-40 repeat |
![]() |
Primer_f | CAGAGAACGATCGCTTTGAGG |
---|---|
Primer_r | CTATATCGAGGCACTGCATGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |