Gene/Protein Characteristic Table for FLJ00165

Description

Product ID:	ORK06138
Accession No.:	AK074094
Alias Name:
Clone Name:	sh07210 [Vector Info]
Source:	Human spleen

Features of the cloned DNA sequence	Description

Length: 5194
Physical map
Restiction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4751 bp

Genome contig ID gi29824593r_40907357
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
ATGTTACAGTGAAACATTAAAACTACAGCAAAGTG
Flanking genome sequence None

Genomic structure deduced by Blast search against draft genome sequences

Features of the predicted protein sequence	Description

Length: 146

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB84920	1.7e-58	100.0	FLJ00165 protei...	Homo sapiens
Q8NET5	2.6e-58	100.0	NFAT activation...	Homo sapiens
XP_001170811	5.6e-57	97.9	similar to NFAT...	Pan troglodytes
XP_001107378	1.4e-49	87.0	similar to NFAT...	Macaca mulatta
XP_001503055	1.7e-35	66.4	similar to NFAT...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other entries from Kazusa human cDNA project (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

None - - - - -

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 39 61 KLLLFGFTGLLSVLSVVGTALLL

Method	From	To	amino acid sequence
SOSUI	39	61	KLLLFGFTGLLSVLSVVGTALLL

Back to the homepage of this database

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4751 bp
Genome contig ID	gi29824593r_40907357
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- ATGTTACAGTGAAACATTAAAACTACAGCAAAGTG
Flanking genome sequence	None