ROUGE

Gene/Protein Characteristic Table for mKIAA0379

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220336
Description :
Clone Name :	mtj01105 [Vector Info]
Source :	Mouse adult thymus

Features of the cloned DNA sequence	Description

Length: 4386 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3252 bp

Genome contig ID gi65540054r_29730771
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
CTTTTAAATGAAATAAAAATTTTTAATGTAAAAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCAAGTGTCTTTCTTTTTTACATATAAAGAACTTTTTTCTTTAAAATGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0379 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0379	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..1134
Length: 377 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q505D1	2.5e-155	100.0	Serine/threonin...	Mus musculus
EDL24818	2.5e-155	100.0	ankyrin repeat ...	Mus musculus
XP_224620	5.4e-154	98.7	similar to anky...	Rattus norvegicus
XP_001057687	5.6e-154	98.7	similar to Anky...	Rattus norvegicus
EAW64258	2.8e-150	96.0	ankyrin repeat ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AB093299	2.7e-16	31.9	mKIAA1728
AK220375	1.8e-15	31.9	mKIAA1223
AK122478	7.8e-13	33.6	mKIAA1250
AK173316	1.9e-12	31.6	mKIAA1981
AK129297	3.1e-12	31.3	mKIAA1139

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 43 55 PR01415 Ankyrin

IPR002110 159 171 PR01415 Ankyrin

HMMPfam IPR002110 9 41 PF00023 Ankyrin

IPR002110 42 78 PF00023 Ankyrin

IPR002110 79 109 PF00023 Ankyrin

IPR002110 111 144 PF00023 Ankyrin

IPR002110 146 178 PF00023 Ankyrin

IPR002110 179 212 PF00023 Ankyrin

IPR002110 213 245 PF00023 Ankyrin

IPR002110 249 281 PF00023 Ankyrin

HMMSmart IPR002110 9 38 SM00248 Ankyrin

IPR002110 42 71 SM00248 Ankyrin

IPR002110 79 108 SM00248 Ankyrin

IPR002110 111 142 SM00248 Ankyrin

IPR002110 146 175 SM00248 Ankyrin

IPR002110 179 209 SM00248 Ankyrin

IPR002110 213 242 SM00248 Ankyrin

IPR002110 249 278 SM00248 Ankyrin

ProfileScan IPR002110 1 315 PS50297 Ankyrin

IPR002110 9 41 PS50088 Ankyrin

IPR002110 42 74 PS50088 Ankyrin

IPR002110 79 101 PS50088 Ankyrin

IPR002110 146 178 PS50088 Ankyrin

IPR002110 179 212 PS50088 Ankyrin

IPR002110 249 281 PS50088 Ankyrin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	43	55	PR01415	Ankyrin
IPR002110	159	171	PR01415	Ankyrin
HMMPfam	IPR002110	9	41	PF00023	Ankyrin
IPR002110	42	78	PF00023	Ankyrin
IPR002110	79	109	PF00023	Ankyrin
IPR002110	111	144	PF00023	Ankyrin
IPR002110	146	178	PF00023	Ankyrin
IPR002110	179	212	PF00023	Ankyrin
IPR002110	213	245	PF00023	Ankyrin
IPR002110	249	281	PF00023	Ankyrin
HMMSmart	IPR002110	9	38	SM00248	Ankyrin
IPR002110	42	71	SM00248	Ankyrin
IPR002110	79	108	SM00248	Ankyrin
IPR002110	111	142	SM00248	Ankyrin
IPR002110	146	175	SM00248	Ankyrin
IPR002110	179	209	SM00248	Ankyrin
IPR002110	213	242	SM00248	Ankyrin
IPR002110	249	278	SM00248	Ankyrin
ProfileScan	IPR002110	1	315	PS50297	Ankyrin
IPR002110	9	41	PS50088	Ankyrin
IPR002110	42	74	PS50088	Ankyrin
IPR002110	79	101	PS50088	Ankyrin
IPR002110	146	178	PS50088	Ankyrin
IPR002110	179	212	PS50088	Ankyrin
IPR002110	249	281	PS50088	Ankyrin

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3252 bp
Genome contig ID	gi65540054r_29730771
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- CTTTTAAATGAAATAAAAATTTTTAATGTAAAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCAAGTGTCTTTCTTTTTTACATATAAAGAACTTTTTTCTTTAAAATGT

Gene/Protein Characteristic Table for mKIAA0379

Features of the cloned DNA sequence

Features of the protein sequence