HUGE

Gene/Protein Characteristic Table for KIAA1960

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00957
Accession No. :	AB075840
Description :	Protein Shroom1.
HUGO Gene Name :	shroom family member 1 (SHROOM1)
Clone Name :	hk03842 [Vector Info]
Flexi ORF Clone :	pF1KSDA1960
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4017 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 653 bp

Genome contig ID gi51511721r_132085734
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
CAGCCTATTTTTTCTTCAATAAAAATTGTTAAGAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGTGTGTGTGTCATCTGCAGCACAGCTGTGGGAGGAGTGAGAGGGGTCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 r 132185734 132194489 10 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 871 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_527007	98.4	apical protein ...	Pan troglodytes
Q2M3G4	100.0	Protein Shroom1...	Homo sapiens
EAW62311	99.4	apical protein ...	Homo sapiens
AAM15526	99.3	apical protein ...	Homo sapiens
XP_001100079	92.4	similar to apic...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040914	4.7e-08	23.3	KIAA1481
AB033028	2.1e-06	30.4	KIAA1202

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR014800 126 292 PF08688 Apx/shroom

IPR014799 566 843 PF08687 Apx/shroom

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014800	126	292	PF08688	Apx/shroom
IPR014799	566	843	PF08687	Apx/shroom

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCTATGTGACCCTCTTGCTTC

Primer_r
: GGGTGAAGCTGAACTGATAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	653 bp
Genome contig ID	gi51511721r_132085734
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CAGCCTATTTTTTCTTCAATAAAAATTGTTAAGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGTGTGTGTGTCATCTGCAGCACAGCTGTGGGAGGAGTGAGAGGGGTCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	r	132185734	132194489	10	100.0	Perfect prediction

Primer_f	: TCTATGTGACCCTCTTGCTTC
Primer_r	: GGGTGAAGCTGAACTGATAGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1960

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information