HUGE

Gene/Protein Characteristic Table for KIAA1537

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00857
Accession No. :	AB040970
Description :	RUN and FYVE domain-containing protein 2.
HUGO Gene Name :	RUN and FYVE domain containing 2 (RUFY2)
Clone Name :	fj02581s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1537
Source :	Human fetal brain
Note :	We replaced fj02581, former representative clones for KIAA1537 with fj02581s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 2110 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 248 bp

Genome contig ID gi89161187r_69670870
PolyA signal sequence
(ATTAAA,-26)
+----*----+----*----+----*----+----
ATTGAGAATATTAAAGTAAATTACCACATACCTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTTTCCTCATCAATTAAAACAAACCCTTCCACTGCCCTGTCAGACTAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 69770870 69836713 19 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 619 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8WXA3	6.8e-181	100.0	RUN and FYVE do...	Homo sapiens
EAW54294	1.9e-176	98.1	RUN and FYVE do...	Homo sapiens
AAL67520	3.9e-176	100.0	RUFY2 [Homo sap...	Homo sapiens
Q5R5R4	8.4e-176	99.7	RUN and FYVE do...	Pongo abelii
XP_001503659	4e-175	98.4	RUN and FYVE do...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020678	6.5e-28	62.9	KIAA0871

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004012 58 182 PF02759 RUN

IPR000306 548 612 PF01363 Zinc finger

HMMSmart IPR004012 118 180 SM00593 RUN

IPR000306 545 612 SM00064 Zinc finger

ProfileScan IPR004012 50 182 PS50826 RUN

IPR000306 553 611 PS50178 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004012	58	182	PF02759	RUN
IPR000306	548	612	PF01363	Zinc finger
HMMSmart	IPR004012	118	180	SM00593	RUN
IPR000306	545	612	SM00064	Zinc finger
ProfileScan	IPR004012	50	182	PS50826	RUN
IPR000306	553	611	PS50178	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGGAAGCTGAAGATGAGGATG

Primer_r
: AGTCTGCCTCCATTCCTTCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	248 bp
Genome contig ID	gi89161187r_69670870
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- ATTGAGAATATTAAAGTAAATTACCACATACCTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTTTCCTCATCAATTAAAACAAACCCTTCCACTGCCCTGTCAGACTAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	69770870	69836713	19	99.9	Perfect prediction

Primer_f	: TGGAAGCTGAAGATGAGGATG
Primer_r	: AGTCTGCCTCCATTCCTTCTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1537

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information