HUGE

Gene/Protein Characteristic Table for KIAA1478

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06577
Accession No. :	AB040911
Description :	Rac GTPase-activating protein 1.
HUGO Gene Name :
Clone Name :	fj05212 [Vector Info]
Flexi ORF Clone :	pF1KA1478
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 2818 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1104 bp

Genome contig ID gi89161190r_48569214
PolyA signal sequence
(AGTAAA,-22)
+----*----+----*----+----*----+----
TATTTGGAAAAAAAGTAAATAGCTTTTTCAAAATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACATGAGGCTGGTTTTCTTGTCTTGCAAGGTAATTTTCAATGCCTTTTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 r 48669214 48686586 15 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 570 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9H0H5	100.0	Rac GTPase-acti...	Homo sapiens
BAA90247	99.8	GTPase activati...	Homo sapiens
XP_001156282	99.5	hypothetical pr...	Pan troglodytes
XP_001156917	99.5	hypothetical pr...	Pan troglodytes
BAG38131	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014521	2.6e-13	31.0	KIAA0621
AB037845	2.6e-12	27.1	KIAA1424
AB040934	8e-12	27.2	KIAA1501
AB014572	1.1e-09	29.0	KIAA0672
AB033030	1.3e-09	26.6	KIAA1204

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002219 225 276 PF00130 Protein kinase C

IPR000198 301 451 PF00620 RhoGAP

HMMSmart IPR002219 225 273 SM00109 Protein kinase C

IPR000198 298 474 SM00324 RhoGAP

ProfileScan IPR002219 224 273 PS50081 Protein kinase C

IPR000198 287 477 PS50238 RhoGAP

ScanRegExp IPR002219 225 273 PS00479 Protein kinase C

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002219	225	276	PF00130	Protein kinase C
IPR000198	301	451	PF00620	RhoGAP
HMMSmart	IPR002219	225	273	SM00109	Protein kinase C
IPR000198	298	474	SM00324	RhoGAP
ProfileScan	IPR002219	224	273	PS50081	Protein kinase C
IPR000198	287	477	PS50238	RhoGAP
ScanRegExp	IPR002219	225	273	PS00479	Protein kinase C

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGGCTATAAGGGAAGATTGTC

Primer_r
: GATAAGGGTCAATACGAAGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1104 bp
Genome contig ID	gi89161190r_48569214
PolyA signal sequence (AGTAAA,-22)	+--------+--------+----*----+---- TATTTGGAAAAAAAGTAAATAGCTTTTTCAAAATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACATGAGGCTGGTTTTCTTGTCTTGCAAGGTAATTTTCAATGCCTTTTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	r	48669214	48686586	15	99.6	Perfect prediction

Primer_f	: AGGCTATAAGGGAAGATTGTC
Primer_r	: GATAAGGGTCAATACGAAGTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1478

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information