HUGE

Gene/Protein Characteristic Table for KIAA0964

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00700
Accession No. :	AB023181
Description :	Disks large-associated protein 4.
HUGO Gene Name :	discs, large (Drosophila) homolog-associated protein 4 (DLGAP4)
Clone Name :	hj06154 [Vector Info]
Flexi ORF Clone :	pF1KSDA0964
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5007 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1602 bp

Genome contig ID gi51511747f_34328858
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CAGGCATGTTGTGAGAATAAATGAGGTAACGTGTA
Flanking genome sequence
(261594 - 261643)
----+----*----+----*----+----*----+----*----+----*
CCAAGGGCTTGTGGCATTATTGCAGGGGGATGAGCAGAGTGGGCCCAGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 f 34357717 34590450 13 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 999 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09920	100.0	disks large-ass...	synthetic construct
CAI17928	99.9	discs, large (D...	Homo sapiens
XP_001095952	99.7	similar to disk...	Macaca mulatta
XP_001135968	99.7	disks large-ass...	Pan troglodytes
XP_001502031	97.6	discs, large (D...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D13633	0.00023	25.4	KIAA0008

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005026 663 999 PF03359 Guanylate-kinase-associated protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005026	663	999	PF03359	Guanylate-kinase-associated protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CACCGCTGAGCAGATGAGAGA

Primer_r
: TTTGCTGAAGGAAGAAGGGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1602 bp
Genome contig ID	gi51511747f_34328858
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CAGGCATGTTGTGAGAATAAATGAGGTAACGTGTA
Flanking genome sequence (261594 - 261643)	----+--------+--------+--------+--------+----* CCAAGGGCTTGTGGCATTATTGCAGGGGGATGAGCAGAGTGGGCCCAGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	f	34357717	34590450	13	99.4	Perfect prediction

Primer_f	: CACCGCTGAGCAGATGAGAGA
Primer_r	: TTTGCTGAAGGAAGAAGGGGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0964

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information