HUGE

Gene/Protein Characteristic Table for KIAA0601

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00571
Accession No. :	AB011173
Description :	Lysine-specific histone demethylase 1.
HUGO Gene Name :	amine oxidase (flavin containing) domain 2 (AOF2)
Clone Name :	hg00838a [Vector Info]
Flexi ORF Clone :	pF1KSDA0601
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 2985 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 886 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60341	100.0	Lysine-specific...	Homo sapiens
AAH48134	99.9	Amine oxidase (...	Homo sapiens
XP_866610	99.1	similar to Lysi...	Canis lupus fam...
XP_612243	98.7	amine oxidase (...	Bos taurus
Q6ZQ88	98.1	Lysine-specific...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007526 208 298 PF04433 SWIRM

IPR002937 322 860 PF01593 Amine oxidase

ProfileScan IPR007526 208 307 PS50934 SWIRM

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007526	208	298	PF04433	SWIRM
IPR002937	322	860	PF01593	Amine oxidase
ProfileScan	IPR007526	208	307	PS50934	SWIRM

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GCTTGCCTCCTTTGAATGACC

Primer_r
: TTGCTTGCCTCAGTCTTTACG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GCTTGCCTCCTTTGAATGACC
Primer_r	: TTGCTTGCCTCAGTCTTTACG
PCR product length	: 88 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0601

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information