HUGE

Gene/Protein Characteristic Table for KIAA0424

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00073
Accession No. :	AB007884
Description :	Rho guanine nucleotide exchange factor 9.
HUGO Gene Name :	Cdc42 guanine nucleotide exchange factor (GEF) 9 (ARHGEF9)
Clone Name :	hh01267 [Vector Info]
Flexi ORF Clone :	pF1KA0424
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5413 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3061 bp

Genome contig ID gi89161218r_62671573
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ATATTTATGGAGTTCAATAAAAGAAGTAAAAAGAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCTCCTGGCATAGCTCTCGTTCGTGTGTGTGTGTGTGTGTGTGTGTGTG

Features of the protein sequence	Description

Length: 567 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O43307	2.6e-212	100.0	Rho guanine nuc...	Homo sapiens
BAF82682	5.4e-212	99.8	unnamed protein...	Homo sapiens
EAX05416	2e-211	99.8	Cdc42 guanine n...	Homo sapiens
XP_001489431	3.4e-211	99.6	similar to Cdc4...	Equus caballus
CAM18135	4.5e-210	98.8	Cdc42 guanine n...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029035	1.5e-91	58.5	KIAA1112
AB037836	4.6e-22	34.2	KIAA1415
AB002360	1.8e-09	24.3	KIAA0362
AB018336	4.6e-09	24.1	KIAA0793
AB002335	2.8e-08	23.0	KIAA0337

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001452 65 113 PD000066 Src homology-3

FPrintScan IPR001452 76 91 PR00452 Src homology-3

IPR001452 93 102 PR00452 Src homology-3

IPR001452 104 116 PR00452 Src homology-3

HMMPfam IPR001452 77 116 PF00018 Src homology-3

IPR000219 158 337 PF00621 DH

IPR001849 370 476 PF00169 Pleckstrin-like

HMMSmart IPR001452 62 117 SM00326 Src homology-3

IPR000219 158 337 SM00325 DH

IPR001849 370 478 SM00233 Pleckstrin-like

ProfileScan IPR001452 59 118 PS50002 Src homology-3

IPR000219 154 338 PS50010 DH

IPR001849 369 476 PS50003 Pleckstrin-like

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	65	113	PD000066	Src homology-3
FPrintScan	IPR001452	76	91	PR00452	Src homology-3
IPR001452	93	102	PR00452	Src homology-3
IPR001452	104	116	PR00452	Src homology-3
HMMPfam	IPR001452	77	116	PF00018	Src homology-3
IPR000219	158	337	PF00621	DH
IPR001849	370	476	PF00169	Pleckstrin-like
HMMSmart	IPR001452	62	117	SM00326	Src homology-3
IPR000219	158	337	SM00325	DH
IPR001849	370	478	SM00233	Pleckstrin-like
ProfileScan	IPR001452	59	118	PS50002	Src homology-3
IPR000219	154	338	PS50010	DH
IPR001849	369	476	PS50003	Pleckstrin-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GAGCAGCAAGGGTAATCAAAG

Primer_r
: GTGTGAAGCCAAATAGTGATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: X

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GAGCAGCAAGGGTAATCAAAG
Primer_r	: GTGTGAAGCCAAATAGTGATC
PCR product length	: 113 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3061 bp
Genome contig ID	gi89161218r_62671573
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ATATTTATGGAGTTCAATAAAAGAAGTAAAAAGAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCTCCTGGCATAGCTCTCGTTCGTGTGTGTGTGTGTGTGTGTGTGTGTG

Gene/Protein Characteristic Table for KIAA0424

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information