HUGE

Gene/Protein Characteristic Table for KIAA1415

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06477
Accession No. :	AB037836
Description :	Phosphatidylinositol 3,4,5-trisphosphate-dependent Rac exchanger 1 protein.
HUGO Gene Name :	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1 (PREX1)
Clone Name :	hg04328s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hg04328, former representative clones for KIAA1415 with hg04328s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6496 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1630 bp

Genome contig ID gi51511747r_46574200
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
ATTTTTTATTATTATTAAAAGTCAGTTTATAATAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGAACGAGGCTGTGATCTGCTTCATCTGCGGTGGGTGGCTTGGGGGGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 r 46674200 46877690 40 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1621 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW75684	100.0	phosphatidylino...	Homo sapiens
CAC86401	99.9	P-Rex1 protein ...	Homo sapiens
Q8TCU6	99.9	Phosphatidylino...	Homo sapiens
XP_605801	93.9	similar to PREX...	Bos taurus
Q69ZK0	91.3	Phosphatidylino...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029035	1.3e-27	36.4	KIAA1112
AB007884	3e-24	34.2	KIAA0424
AB002335	7.9e-14	30.9	KIAA0337
AB018336	1.5e-11	28.9	KIAA0793
AB033082	2e-11	25.9	KIAA1256

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000219 15 201 PF00621 DH

IPR001849 234 354 PF00169 Pleckstrin-like

IPR000591 383 456 PF00610 Pleckstrin/ G-protein

IPR000591 485 557 PF00610 Pleckstrin/ G-protein

IPR001478 588 665 PF00595 PDZ/DHR/GLGF

HMMSmart IPR000219 15 201 SM00325 DH

IPR001849 234 356 SM00233 Pleckstrin-like

IPR000591 385 458 SM00049 Pleckstrin/ G-protein

IPR000591 486 559 SM00049 Pleckstrin/ G-protein

IPR001478 595 668 SM00228 PDZ/DHR/GLGF

IPR001478 679 750 SM00228 PDZ/DHR/GLGF

ProfileScan IPR000219 11 202 PS50010 DH

IPR001849 233 354 PS50003 Pleckstrin-like

IPR000591 383 458 PS50186 Pleckstrin/ G-protein

IPR000591 491 559 PS50186 Pleckstrin/ G-protein

IPR001478 587 634 PS50106 PDZ/DHR/GLGF

ScanRegExp IPR001331 150 175 PS00741 Guanine-nucleotide dissociation stimulator

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000219	15	201	PF00621	DH
IPR001849	234	354	PF00169	Pleckstrin-like
IPR000591	383	456	PF00610	Pleckstrin/ G-protein
IPR000591	485	557	PF00610	Pleckstrin/ G-protein
IPR001478	588	665	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR000219	15	201	SM00325	DH
IPR001849	234	356	SM00233	Pleckstrin-like
IPR000591	385	458	SM00049	Pleckstrin/ G-protein
IPR000591	486	559	SM00049	Pleckstrin/ G-protein
IPR001478	595	668	SM00228	PDZ/DHR/GLGF
IPR001478	679	750	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR000219	11	202	PS50010	DH
IPR001849	233	354	PS50003	Pleckstrin-like
IPR000591	383	458	PS50186	Pleckstrin/ G-protein
IPR000591	491	559	PS50186	Pleckstrin/ G-protein
IPR001478	587	634	PS50106	PDZ/DHR/GLGF
ScanRegExp	IPR001331	150	175	PS00741	Guanine-nucleotide dissociation stimulator

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTCCTTCAACGTCCACATTCC

Primer_r
: TTTTCCAAGTCCACCAAGCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TTCCTTCAACGTCCACATTCC
Primer_r	: TTTTCCAAGTCCACCAAGCAG
PCR product length	: 107 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1630 bp
Genome contig ID	gi51511747r_46574200
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- ATTTTTTATTATTATTAAAAGTCAGTTTATAATAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGAACGAGGCTGTGATCTGCTTCATCTGCGGTGGGTGGCTTGGGGGGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	r	46674200	46877690	40	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA1415

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information