| HUGE | 
| Gene/Protein Characteristic Table for KIAA0090 | 
| Link to : 
Rouge | 
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00012 | 
|---|---|
| Accession No. : | D42044 | 
| Description : | |
| HUGO Gene Name : | |
| Clone Name : | eh00576 [Vector Info] | 
| Flexi ORF Clone : | pF1KA0090  | 
| Source : | |
| Note : | We replaced ha03523, former representative clones for KIAA0090 with eh00576. (2005/08/06) | 
| Features of the cloned DNA sequence | Description | |
|---|---|---|
Length: 5411 bp
|   | 
| cloned DNA seq. | |
| Warning for N-terminal truncation: | YES | 
| Warning for coding interruption: | NO | 
Length of 3'UTR 2435 bp Genome contig ID gi89161185r_19316071 PolyA signal sequence 
(None)
GACCAGCCTGGGCAACATAGCAAGACTCTATCTACFlanking genome sequence 
(99884 - 99835)
AAAAAATAAAAAAAAATTAGCCGGGCCTGGTGGCATGTGCCTGTGGTCCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 r 19415955 19450587 23 99.5 Perfect prediction 
| Features of the protein sequence | Description | |
|---|---|---|
Length: 991 aa
|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
 
    | Expression profile | Description | |
|---|---|---|
| RH mapping information | Description | |
|---|---|---|
| : | 
| : | |
| : - | |
| : - | |
| : - | |
| : - | 
| How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage   | |