ROUGE |
Gene/Protein Characteristic Table for mKIAA0090 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129052 |
---|---|
RIKEN cDNA C230096C10. | |
mbg13527 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4843 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1863 bp Genome contig ID gi65493515f_138133896 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
TGACCACGCTCCTGGAATAAAGCTGATGATCAGTGFlanking genome sequence
(124821 - 124870) ----+----*----+----*----+----*----+----*----+----*
GCTCAGCTTTGTTTTGTGTCTTCAGAGTTCACTTCAAGGCTGCTTTTGAT
KIAA Alignment based on: KIAA0090 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 2..2980
Length: 992 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |