HUGE

Gene/Protein Characteristic Table for KIAA0012

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01951
Accession No. :	D13637
Description :	Toll-like receptor 1 precursor.
HUGO Gene Name :	toll-like receptor 1 (TLR1)
Clone Name :	ha00413 [Vector Info]
Flexi ORF Clone :	pF1KA0012
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 2621 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 197 bp

Genome contig ID gi89161207r_38374290
PolyA signal sequence
(ATTAAA,-34)
+----*----+----*----+----*----+----
TATTAAAAATTAATGAAATGATATAACTTTGATTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACAGTTCTGACACATAAGGGATCCACTTGTTTCTTTGCTATAACTGAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 r 38474290 38476910 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 789 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG72826	100.0	toll-like recep...	synthetic construct
Q15399	99.9	Toll-like recep...	Homo sapiens
AAC34137	99.6	Toll-like recep...	Homo sapiens
BAF85671	99.6	unnamed protein...	Homo sapiens
AAH89403	99.5	Toll-like recep...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020669	1.3e-05	26.0	KIAA0862
AB040930	0.00014	29.5	KIAA1497
AB011537	0.0003	24.1	KIAA0813
AB037858	0.0004	21.4	KIAA1437
AB011538	0.001	21.3	KIAA0814

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 98 111 PR00019 Leucine-rich repeat

IPR001611 400 413 PR00019 Leucine-rich repeat

IPR004075 675 702 PR01537 Interleukin-1 receptor

IPR004075 713 738 PR01537 Interleukin-1 receptor

IPR004075 764 783 PR01537 Interleukin-1 receptor

HMMPfam IPR001611 73 95 PF00560 Leucine-rich repeat

IPR001611 97 115 PF00560 Leucine-rich repeat

IPR001611 118 138 PF00560 Leucine-rich repeat

IPR001611 449 470 PF00560 Leucine-rich repeat

IPR001611 472 492 PF00560 Leucine-rich repeat

IPR001611 494 516 PF00560 Leucine-rich repeat

IPR000483 556 581 PF01463 Cysteine-rich flanking region

IPR000157 642 778 PF01582 Toll-Interleukin receptor

HMMSmart IPR003591 71 94 SM00369 Leucine-rich repeat

IPR003591 116 140 SM00369 Leucine-rich repeat

NULL 374 393 SM00364 NULL

IPR003591 374 397 SM00369 Leucine-rich repeat

NULL 447 466 SM00364 NULL

NULL 470 489 SM00364 NULL

IPR003591 470 494 SM00369 Leucine-rich repeat

IPR000483 527 581 SM00082 Cysteine-rich flanking region

IPR000157 639 782 SM00255 Toll-Interleukin receptor

ProfileScan IPR000157 638 782 PS50104 Toll-Interleukin receptor

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	98	111	PR00019	Leucine-rich repeat
IPR001611	400	413	PR00019	Leucine-rich repeat
IPR004075	675	702	PR01537	Interleukin-1 receptor
IPR004075	713	738	PR01537	Interleukin-1 receptor
IPR004075	764	783	PR01537	Interleukin-1 receptor
HMMPfam	IPR001611	73	95	PF00560	Leucine-rich repeat
IPR001611	97	115	PF00560	Leucine-rich repeat
IPR001611	118	138	PF00560	Leucine-rich repeat
IPR001611	449	470	PF00560	Leucine-rich repeat
IPR001611	472	492	PF00560	Leucine-rich repeat
IPR001611	494	516	PF00560	Leucine-rich repeat
IPR000483	556	581	PF01463	Cysteine-rich flanking region
IPR000157	642	778	PF01582	Toll-Interleukin receptor
HMMSmart	IPR003591	71	94	SM00369	Leucine-rich repeat
IPR003591	116	140	SM00369	Leucine-rich repeat
NULL	374	393	SM00364	NULL
IPR003591	374	397	SM00369	Leucine-rich repeat
NULL	447	466	SM00364	NULL
NULL	470	489	SM00364	NULL
IPR003591	470	494	SM00369	Leucine-rich repeat
IPR000483	527	581	SM00082	Cysteine-rich flanking region
IPR000157	639	782	SM00255	Toll-Interleukin receptor
ProfileScan	IPR000157	638	782	PS50104	Toll-Interleukin receptor

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 7 IFHFAIIFMLILQIRIQLSEESE 29 SECONDARY 23

2 580 CNITLLIVTIVATMLVLAVTVTS 602 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	7	IFHFAIIFMLILQIRIQLSEESE	29	SECONDARY	23
2	580	CNITLLIVTIVATMLVLAVTVTS	602	PRIMARY	23

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TGCCCATCACAATCTCTTTC
Primer_r	: TATTTCTTTGCTTGCTCTGT
PCR product length	: 222 bp
PCR conditions	: 95 °C15 sec58 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	197 bp
Genome contig ID	gi89161207r_38374290
PolyA signal sequence (ATTAAA,-34)	+--------+--------+----*----+---- TATTAAAAATTAATGAAATGATATAACTTTGATTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACAGTTCTGACACATAAGGGATCCACTTGTTTCTTTGCTATAACTGAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	r	38474290	38476910	1	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0012

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information