KIAA1831

Product ID	ORK00929
Accession No	AB058734
Description	junctophilin 4, transcript variant 1
Clone name	hk00543
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4278 bp) Predicted protein sequence (663 aa)
HaloTag ORF Clone	FHC00929
Flexi ORF Clone	FXC00929
Source	Human adult brain

Length: 4278 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1599 bp
Genome contig ID	gi51511730r_23007144
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AAAAAAATATATTAATAAAAAAGTTCAAAAAAGGG
Flanking genome sequence (99940 - 99891)	----+--------+--------+--------+--------+----* GGGGGATTGTCATCTCCTTTGGGGTGCGATGGCTTCAAATCCAAACTGAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	23107084	23117849	6	100.0	Perfect prediction

Length: 663 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96JJ6	3.9e-204	100.0	Junctophilin-4;...	Homo sapiens
BAF83200	9.5e-204	99.7	unnamed protein...	Homo sapiens
AAH55429	2.9e-203	99.7	Junctophilin 4 ...	Homo sapiens
XP_001109175	7.2e-203	99.4	junctophilin 4 ...	Macaca mulatta
EDM14220	3e-196	96.3	rCG23591 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003409	50	72	PF02493	MORN motif
	IPR003409	74	95	PF02493	MORN motif
	IPR003409	96	117	PF02493	MORN motif
	IPR003409	118	140	PF02493	MORN motif
	IPR003409	141	163	PF02493	MORN motif
	IPR003409	164	186	PF02493	MORN motif
	IPR003409	317	339	PF02493	MORN motif
	IPR003409	340	362	PF02493	MORN motif
HMMSmart	IPR003409	48	69	SM00698	MORN motif
	IPR003409	94	115	SM00698	MORN motif
	IPR003409	139	160	SM00698	MORN motif
	IPR003409	162	183	SM00698	MORN motif
	IPR003409	315	336	SM00698	MORN motif
	IPR003409	338	359	SM00698	MORN motif

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	639	ANPLVVGAVALLDLSLAFLFSQL	661	PRIMARY	23

Primer_f	TAGGACCAGACAAGATAACAG
Primer_r	TTTGATCCCCTCCTTCTGTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-