KIAA0828

Product ID	ORK00647
Accession No	AB020635
Description	adenosylhomocysteinase-like 2, transcript variant 2
Clone name	hh04230
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5025 bp) Predicted protein sequence (619 aa)
Flexi ORF Clone	FXC00647
Source	Human adult brain
Rouge ID	mKIAA0828 by Kazusa Mouse cDNA Project

Length: 5025 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3165 bp
Genome contig ID	gi89161213f_128552127
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AATCTCAAAAAACAAATAAAATATTCTTAACATGG
Flanking genome sequence (305162 - 305211)	----+--------+--------+--------+--------+----* ACTCTTAAGGGTATTTCTTGTTTCTGTGAACTAGAAATTCAGAGATGAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	128652127	128857287	17	100.0	Perfect prediction

Length: 619 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96HN2	8.5e-198	99.8	Putative adenos...	Homo sapiens
AAI48037	1.4e-196	99.0	AHCYL2 protein ...	Bos taurus
EDM15234	2.5e-196	98.7	rCG27985 [Rattu...	Rattus norvegicus
Q68FL4	8.9e-196	98.7	Putative adenos...	Mus musculus
XP_231564	7.7e-189	94.7	similar to Puta...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000043	192	618	PF05221	S-adenosyl-L-homocysteine hydrolase
HMMPfam	IPR015878	378	539	PF00670	S-adenosyl-L-homocysteine hydrolase
HMMTigr	IPR000043	194	611	TIGR00936	S-adenosyl-L-homocysteine hydrolase
ScanRegExp	IPR000043	265	279	PS00738	S-adenosyl-L-homocysteine hydrolase
ScanRegExp	IPR000043	400	417	PS00739	S-adenosyl-L-homocysteine hydrolase

Primer_f	CCTCCCTCCCTATCCTACTTG
Primer_r	TTGAGAAAACCACAGGAGCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-