KIAA0543

Product ID	ORK05609
Accession No	AB011115
Description	zinc finger protein 862
Clone name	hg04390
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6443 bp) Predicted protein sequence (1111 aa)
Source	Human adult brain
Rouge ID	mKIAA0543 by Kazusa Mouse cDNA Project

Length: 6443 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3106 bp
Genome contig ID	gi89161213f_149074210
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTTTGCTACCTGAATAAAGCAGAGTCTATTTCAAC
Flanking genome sequence (121290 - 121339)	----+--------+--------+--------+--------+----* ACATCTCTGTCTTGTGTGTCCCTAAGCGAGGACCAGGAGCTCAGAGAAGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	149174210	149195498	7	99.1	Perfect prediction

Length: 1111 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O60290	100.0	Zinc finger pro...	Homo sapiens
EAW80026	100.0	hCG16180 [Homo ...	Homo sapiens
XP_001101093	96.0	similar to Zinc...	Macaca mulatta
XP_001494367	85.9	similar to zinc...	Equus caballus
XP_001787729	80.1	similar to zinc...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046806	3.6e-16	22.4	KIAA1586
AB033111	5.1e-09	36.0	KIAA1285
AB058755	6.3e-08	33.5	KIAA1852
AB058709	1.8e-07	46.2	KIAA1806
AB046808	2.6e-07	36.8	KIAA1588

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001909	275	315	PF01352	KRAB box
HMMPfam	IPR008906	931	1014	PF05699	HAT dimerisation
HMMSmart	IPR006580	77	160	SM00597	Zinc finger
	IPR001909	275	335	SM00349	KRAB box
	IPR006580	403	486	SM00597	Zinc finger
ProfileScan	IPR001909	275	346	PS50805	KRAB box

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	961	FPLLSKLMAVVVCVPISTSCCER	983	PRIMARY	23

Primer_f	GGGTCTGACATTCCAAGTAAC
Primer_r	AGGTATCTTCCAGGACAGGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGGTCTGACATTCCAAGTAAC
Primer_r	AGGTATCTTCCAGGACAGGGG
PCR product length	109 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles