| Order Kazusa clone(s) from :  Japan
 || 
Other countries | 
| Product ID | ORK00379 | 
|---|---|
| Accession No | D25278 | 
| Description | IQ motif containing B1, transcript variant 1 | 
| Clone name | ha02085 | 
| Vector information | |
| cDNA sequence | DNA sequence (2535 bp) Predicted protein sequence (632 aa) | 
| 
    HaloTag ORF Clone | 
    FHC00379
       | 
| Flexi ORF Clone | FXC00379 | 
| Source | Myeloblast cell line (KG-1) | 
| Rouge ID | mKIAA0036
    
    by Kazusa Mouse cDNA Project | 
 Length: 2535 bp
 Length: 2535 bp Physical map
 Physical map 
     Restriction map
 Restriction map Prediction of protein coding region (GeneMark analysis).
 Prediction of protein coding region (GeneMark analysis).
    | N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | No warning | 
 Integrity of 3' end
 Integrity of 3' end
    | Length of 3'UTR | 582 bp | 
|---|---|
| Genome contig ID | gi89161205r_122871300 | 
| PolyA signal sequence (ATTAAA,-21) | +----*----+----*----+----*----+---- | 
| Flanking genome sequence (100000 - 99951) | ----+----*----+----*----+----*----+----*----+----* | 
   Ensembl ContigView  (Add our DAS server as a DAS source)
 Ensembl ContigView  (Add our DAS server as a DAS source)
  
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|  | 3 | r | 122971300 | 123036563 | 15 | 99.4 | Perfect prediction | 
 Length: 632 aa
 
        Length: 632 aa Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)
        Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)|  | 
 | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)
        Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 Result of motif / domain search (InterProScan and SOSUI)
	Result of motif / domain search (InterProScan and SOSUI) Result of InterProScan
 Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition | 
|---|---|---|---|---|---|
| HMMPfam | IPR000048 | 329 | 349 | PF00612 | IQ calmodulin-binding region | 
| IPR000048 | 422 | 442 | PF00612 | IQ calmodulin-binding region | |
| HMMSmart | IPR000048 | 327 | 349 | SM00015 | IQ calmodulin-binding region | 
| IPR000048 | 420 | 442 | SM00015 | IQ calmodulin-binding region | |
| ProfileScan | IPR000048 | 328 | 357 | PS50096 | IQ calmodulin-binding region | 
| IPR000048 | 421 | 450 | PS50096 | IQ calmodulin-binding region | 
 Chromosome No. 6
 Chromosome No. 6 Experimental conditions
 Experimental conditions| Panel name | Genebridge 4 | 
|---|---|
| Primer_f | CCTAGCGAAGTGCCGTAAGA | 
| Primer_r | GCTCCCTACTGACCACATCT | 
| PCR product length | 155 bp | 
| PCR conditions | 95 °C  15 sec  62 °C  60 sec  30 cycles | 
 Japan
 || 
Other countries
Japan
 || 
Other countries