|
Order Kazusa clone(s) from : |
| Product ID | ORK00368 |
|---|---|
| Accession No | D14664 |
| Description | CD302 molecule, transcript variant 1 |
| Clone name | ha00480 |
| Vector information | |
| cDNA sequence | DNA sequence (3694 bp) Predicted protein sequence (231 aa) |
|
HaloTag ORF Clone |
FHC00368
|
| Flexi ORF Clone | FXC00368 |
| Source | Myeloblast cell line (KG-1) |
Length: 3694 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 2997 bp |
|---|---|
| Genome contig ID | gi89161199r_160233610 |
| PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 2 | r | 160333610 | 160362953 | 6 | 99.1 | Perfect prediction |
Length: 231 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR001304 | 44 | 154 | PF00059 | C-type lectin |
| HMMSmart | IPR001304 | 23 | 153 | SM00034 | C-type lectin |
| ProfileScan | IPR001304 | 31 | 143 | PS50041 | C-type lectin |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 2 | RAALPALLLPLLGLAAAAVADCP | 24 | PRIMARY | 23 | 2 | 168 | ILISALVIASTVILTVLGAIIWF | 190 | PRIMARY | 23 |
|---|
Chromosome No. 2
Experimental conditions| Panel name | Genebridge 4 |
|---|---|
| Primer_f | CAGGCAGGCTTGTTTACTAC |
| Primer_r | GCTTTCATTGGTTATCAGTT |
| PCR product length | 201 bp |
| PCR conditions | 95 °C 15 sec 58 °C 60 sec 30 cycles |