Gene/Protein Characteristic Table for KIAA1954
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07420
Accession No AB075834
Description ZFP90 zinc finger protein
Clone name fk02322
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3846 bp)
Predicted protein sequence (468 aa)
Source Human fetal brain
Rouge ID mKIAA1954 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3846 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 2439 bp
Genome contig ID gi51511732f_67054696
PolyA signal sequence
(AATAAA,-21)		 
+----*----+----*----+----*----+----
CATTGTATTCTTTCAATAAATAGCCTTCTGAGTTG
Flanking genome sequence
(103839 - 103888)		 
----+----*----+----*----+----*----+----*----+----*
AATGGGAGTCAGTTTGTCGTTTTCAATTTTCAGAACTTGGCTAAGATTAA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 16 f 67154696 67158533 1 99.0 Perfect prediction
Features of the protein sequence
Description

Length: 468 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW83235 2.7e-205 100.0 zinc finger pro...
 Homo sapiens
Q8TF47 2.9e-205 100.0 Zinc finger pro...
 Homo sapiens
XP_511056 3.2e-204 99.4 zinc finger pro...
 Pan troglodytes
XP_001092619 3.5e-202 98.1 similar to Zinc...
 Macaca mulatta
XP_001496976 5.4e-198 95.7 similar to zinc...
 Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB058774 1.7e-59 44.4 KIAA1871
AB032967 1.7e-46 43.8 KIAA1141
AB007886 1.2e-44 44.9 KIAA0426
AB075836 3e-42 42.8 KIAA1956
AB075842 2.1e-39 42.6 KIAA1962
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 86 109 PD000003 Zinc finger
IPR007087 114 137 PD000003 Zinc finger
IPR007087 142 165 PD000003 Zinc finger
IPR007087 198 221 PD000003 Zinc finger
IPR007087 282 305 PD000003 Zinc finger
IPR007087 329 352 PD000003 Zinc finger
IPR007087 357 380 PD000003 Zinc finger
IPR007087 385 408 PD000003 Zinc finger
IPR007087 413 436 PD000003 Zinc finger
IPR007087 441 463 PD000003 Zinc finger
HMMPfam IPR007087 43 65 PF00096 Zinc finger
IPR007087 86 108 PF00096 Zinc finger
IPR007087 114 136 PF00096 Zinc finger
IPR007087 142 164 PF00096 Zinc finger
IPR007087 170 192 PF00096 Zinc finger
IPR007087 198 220 PF00096 Zinc finger
IPR007087 226 248 PF00096 Zinc finger
IPR007087 282 304 PF00096 Zinc finger
IPR007087 329 351 PF00096 Zinc finger
IPR007087 357 379 PF00096 Zinc finger
IPR007087 385 407 PF00096 Zinc finger
IPR007087 413 435 PF00096 Zinc finger
IPR007087 441 463 PF00096 Zinc finger
HMMSmart IPR015880 43 65 SM00355 Zinc finger
IPR015880 86 108 SM00355 Zinc finger
IPR015880 114 136 SM00355 Zinc finger
IPR015880 142 164 SM00355 Zinc finger
IPR015880 170 192 SM00355 Zinc finger
IPR015880 198 220 SM00355 Zinc finger
IPR015880 226 248 SM00355 Zinc finger
IPR015880 282 304 SM00355 Zinc finger
IPR015880 329 351 SM00355 Zinc finger
IPR015880 357 379 SM00355 Zinc finger
IPR015880 385 407 SM00355 Zinc finger
IPR015880 413 435 SM00355 Zinc finger
IPR015880 441 463 SM00355 Zinc finger
ProfileScan IPR007087 43 70 PS50157 Zinc finger
IPR007087 86 113 PS50157 Zinc finger
IPR007087 114 141 PS50157 Zinc finger
IPR007087 142 169 PS50157 Zinc finger
IPR007087 170 197 PS50157 Zinc finger
IPR007087 198 225 PS50157 Zinc finger
IPR007087 226 253 PS50157 Zinc finger
IPR007087 282 309 PS50157 Zinc finger
IPR007087 329 356 PS50157 Zinc finger
IPR007087 357 384 PS50157 Zinc finger
IPR007087 385 412 PS50157 Zinc finger
IPR007087 413 440 PS50157 Zinc finger
IPR007087 441 468 PS50157 Zinc finger
ScanRegExp IPR007087 45 65 PS00028 Zinc finger
IPR007087 88 108 PS00028 Zinc finger
IPR007087 116 136 PS00028 Zinc finger
IPR007087 144 164 PS00028 Zinc finger
IPR007087 172 192 PS00028 Zinc finger
IPR006025 185 194 PS00142 Peptidase M
IPR007087 200 220 PS00028 Zinc finger
IPR007087 228 248 PS00028 Zinc finger
IPR007087 284 304 PS00028 Zinc finger
IPR007087 331 351 PS00028 Zinc finger
IPR007087 359 379 PS00028 Zinc finger
IPR007087 387 407 PS00028 Zinc finger
IPR007087 415 435 PS00028 Zinc finger
IPR007087 443 463 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TAGCTGGTTGGGGATGATATG
Primer_r AATGTAAGAGCTGCAGTTGAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 16
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp