KIAA1809

Product ID	ORK00923
Accession No	AB058712
Description	B-cell CLL/lymphoma 11A (zinc finger protein), transcript variant 2
Clone name	fk01629
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2864 bp) Predicted protein sequence (800 aa)
HaloTag ORF Clone	FHC00923
Flexi ORF Clone	FXC00923
Source	Human fetal brain
Rouge ID	mKIAA1809 by Kazusa Mouse cDNA Project

Length: 2864 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	414 bp
Genome contig ID	gi89161199r_60432798
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GTGTGCTTAACATTGACAATAAATGTTGGAGCTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGGTGGTGTTTGCTTGTTCTTTAATTTTTAATGCTTATAAGACAATGAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	60532798	60634037	5	99.2	Perfect prediction

Length: 800 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH21098	100.0	B-cell CLL/lymp...	Homo sapiens
CAC17724	99.6	B-cell lymphoma...	Homo sapiens
XP_865536	99.4	similar to B-ce...	Canis lupus fam...
XP_001158392	99.1	B-cell CLL/lymp...	Pan troglodytes
Q9QYE3	99.0	B-cell lymphoma...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	404	426	PF00096	Zinc finger
HMMPfam	IPR007087	432	454	PF00096	Zinc finger
HMMSmart	IPR015880	197	220	SM00355	Zinc finger
	IPR015880	404	426	SM00355	Zinc finger
	IPR015880	432	454	SM00355	Zinc finger
ProfileScan	IPR007087	197	220	PS50157	Zinc finger
	IPR007087	404	431	PS50157	Zinc finger
	IPR007087	432	459	PS50157	Zinc finger
ScanRegExp	IPR007087	199	220	PS00028	Zinc finger
	IPR007087	406	426	PS00028	Zinc finger
	IPR007087	434	456	PS00028	Zinc finger

Primer_f	CCATTCCAGCCAGGTAGCAAG
Primer_r	AATTTGAACGTCTTGCCGCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-