KIAA1803

Product ID	ORK00282
Accession No	AB058706
Description	zinc finger protein 462
Clone name	fj22564s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-449) was subcloned upstream of the cDNA (450-4691). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGGG CCGCGAATTC ACTAGTGATT-5' end of cDNA.
cDNA sequence	DNA sequence (4691 bp) Predicted protein sequence (1412 aa)
HaloTag ORF Clone	FHC00282
Flexi ORF Clone	FXC00282
Source	Human fetal brain
Rouge ID	mKIAA1803 by Kazusa Mouse cDNA Project
Note	We replaced fj22564, former representative clones for KIAA1803 with fj22564s1. (2002/5/10)

Length: 4691 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	452 bp
Genome contig ID	gi89161216f_108629480
PolyA signal sequence (None)	+--------+--------+----*----+---- AAGCTTTTTCAAGACCTAACTGCAGCCGCTTTGGG
Flanking genome sequence (184106 - 184155)	----+--------+--------+--------+--------+----* AAAAAAAAACAAAAAACAAAAAACAGAAAACAAAAAAAAAAAAACTGCTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	108729480	108813584	11	99.4	Perfect prediction

Length: 1412 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW59010	100.0	zinc finger pro...	Homo sapiens
CAI14941	99.9	zinc finger pro...	Homo sapiens
EAW59011	99.9	zinc finger pro...	Homo sapiens
XP_001109212	99.4	zinc finger pro...	Macaca mulatta
XP_867474	95.7	similar to Zinc...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB107355	2.1e-09	23.2	KIAA2033
AB058709	2e-07	27.1	KIAA1806
AB046831	2.4e-07	24.0	KIAA1611
AB075828	7.6e-07	24.3	KIAA1948
AB037809	7.1e-06	27.7	KIAA1388

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	737	759	PF00096	Zinc finger
	IPR007087	897	919	PF00096	Zinc finger
	IPR007087	931	953	PF00096	Zinc finger
	IPR007087	1206	1228	PF00096	Zinc finger
	IPR007087	1320	1342	PF00096	Zinc finger
HMMSmart	IPR015880	38	61	SM00355	Zinc finger
	IPR015880	110	133	SM00355	Zinc finger
	IPR015880	157	180	SM00355	Zinc finger
	IPR015880	214	237	SM00355	Zinc finger
	IPR015880	315	338	SM00355	Zinc finger
	IPR015880	360	383	SM00355	Zinc finger
	IPR015880	422	445	SM00355	Zinc finger
	IPR015880	505	528	SM00355	Zinc finger
	IPR015880	542	565	SM00355	Zinc finger
	IPR015880	612	635	SM00355	Zinc finger
	IPR015880	691	715	SM00355	Zinc finger
	IPR015880	737	759	SM00355	Zinc finger
	IPR015880	813	835	SM00355	Zinc finger
	IPR015880	897	919	SM00355	Zinc finger
	IPR015880	931	953	SM00355	Zinc finger
	IPR015880	960	983	SM00355	Zinc finger
	IPR015880	989	1012	SM00355	Zinc finger
	IPR015880	1097	1120	SM00355	Zinc finger
	IPR015880	1126	1149	SM00355	Zinc finger
	IPR015880	1160	1182	SM00355	Zinc finger
	IPR015880	1206	1228	SM00355	Zinc finger
	IPR015880	1234	1257	SM00355	Zinc finger
	IPR015880	1320	1342	SM00355	Zinc finger
ProfileScan	IPR007087	315	343	PS50157	Zinc finger
	IPR007087	737	764	PS50157	Zinc finger
	IPR007087	897	919	PS50157	Zinc finger
	IPR007087	931	959	PS50157	Zinc finger
	IPR007087	960	988	PS50157	Zinc finger
	IPR007087	1206	1233	PS50157	Zinc finger
	IPR007087	1234	1262	PS50157	Zinc finger
	IPR007087	1320	1342	PS50157	Zinc finger
ScanRegExp	IPR007087	317	338	PS00028	Zinc finger
	IPR007087	507	528	PS00028	Zinc finger
	IPR007087	739	759	PS00028	Zinc finger
	IPR007087	899	919	PS00028	Zinc finger
	IPR007087	1208	1228	PS00028	Zinc finger
	IPR007087	1322	1342	PS00028	Zinc finger

Primer_f	TTAACTTGGATCAGCTGGAAC
Primer_r	CCCGTCCACAAAATTCACATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-