KIAA1957

Product ID	ORK00955
Accession No	AB075837
Description	C2 calcium-dependent domain containing 4C
Clone name	fk12643
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2976 bp) Predicted protein sequence (481 aa)
HaloTag ORF Clone	FHC00955
Flexi ORF Clone	FXC00955
Source	Human fetal brain

Length: 2976 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1505 bp
Genome contig ID	gi42406306r_256447
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- AAATGCTGTTTATAGTGCAATAAAGGTGTTTCGGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATACGGGGGTGGAGGTTGGCTTCCCTGGCTGTTTAATAACGAGAGAGTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	356447	360170	3	99.1	Perfect prediction

Length: 481 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW61200	1.4e-159	97.9	hCG1659953, iso...	Homo sapiens
CAD39008	3.3e-137	100.0	hypothetical pr...	Homo sapiens
EDL89418	1.5e-129	90.5	rCG29198 [Rattu...	Rattus norvegicus
Q5HZI2	7.4e-129	90.5	Nuclear-localiz...	Mus musculus
BAC26694	5.5e-128	90.0	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	382	471	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	381	481	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000008	381	471	PS50004	C2 calcium-dependent membrane targeting

Primer_f	GTGTGTAAATAGGCTGTGGCT
Primer_r	CATTCAAGGACCCACATAACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-