KIAA1590

Product ID	ORK00251
Accession No	AB046810
Description	kinesin family member 16B, transcript variant 1
Clone name	fj09048y1
Vector information	The cDNA fragment was originally inserted at BssH II-NotI si ... The cDNA fragment was originally inserted at BssH II-NotI site of the pBluescript II SK(+) vector (GenBank Accession No.X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: GCGCGCTAAT ACGACTCACT ATAGGGCGAA TTGGGTACCG GGCCCCACCT CGAGGTCGAC CCACGCGTCC G-5' end of cDNA.
cDNA sequence	DNA sequence (4558 bp) Predicted protein sequence (1393 aa)
HaloTag ORF Clone	FHC00251
Flexi ORF Clone	FXC00251
Source	Human fetal brain
Rouge ID	mKIAA1590 by Kazusa Mouse cDNA Project
Note	We replaced fj09048, former representative clones for KIAA1590 with fj09048y1. (2002/12/27)

Length: 4558 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	303 bp
Genome contig ID	gi51511747r_16195488
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TTATTTGTGAGGTGATTAAAGCATTTCTGATTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGTTTTCGTGTCGATTTATAGTGTGGTGGCTTGGAATCTGTCTGTGCCTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	16295488	16501996	23	99.4	Perfect prediction

Length: 1393 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI50262	100.0	KIF16B protein ...	Homo sapiens
CAI22745	99.9	chromosome 20 o...	Homo sapiens
XP_001086005	97.6	similar to kine...	Macaca mulatta
EAX10289	99.7	chromosome 20 o...	Homo sapiens
Q96L93	99.9	Kinesin-like pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D26361	7.2e-35	40.9	KIAA0042
AB014539	7.5e-31	39.5	KIAA0639
AB011163	9.5e-30	39.5	KIAA0591
AB040881	1.6e-27	35.7	KIAA1448
AB014606	1.4e-26	42.5	KIAA0706

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	94	115	PR00380	Kinesin
	IPR001752	215	232	PR00380	Kinesin
	IPR001752	248	266	PR00380	Kinesin
	IPR001752	309	330	PR00380	Kinesin
HMMPfam	IPR001752	10	360	PF00225	Kinesin
HMMPfam	IPR000253	479	545	PF00498	Forkhead-associated
HMMSmart	IPR001752	2	367	SM00129	Kinesin
ProfileScan	IPR001752	1	278	PS50067	Kinesin
ScanRegExp	IPR001752	247	258	PS00411	Kinesin
ScanRegExp	IPR001220	446	452	PS00307	Legume lectin

Primer_f	GCCAAATGGAGTTCAGGTGTC
Primer_r	GTGTTCAGAAGGACTAGCGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-