KIAA0639

Product ID	ORK00585
Accession No	AB014539
Description	kinesin family member 13B
Clone name	fg02716y2
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (8735 bp) Predicted protein sequence (1835 aa)
HaloTag ORF Clone	FHC00585
Flexi ORF Clone	FXC00585
Source	Human fetal brain
Rouge ID	mKIAA0639 by Kazusa Mouse cDNA Project
Note	We replaced hj03358 and fg02716, former representative clones for KIAA0639 with fg02716y2. (2002/12/27,2003/4/2)

Length: 8735 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3225 bp
Genome contig ID	gi51511724r_28880715
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- AGCTTCTCAATAAAACCAGACCATTTCTCACCTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCATGTCTGAGGCCAGTCTTGTTGCTTCTCCTTCCCCTCACCCCAACAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	28980715	29176499	39	99.5	Perfect prediction

Length: 1835 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09788	100.0	kinesin family ...	synthetic construct
Q9NQT8	99.6	Kinesin-like pr...	Homo sapiens
EAW63491	97.2	kinesin family ...	Homo sapiens
XP_534562	89.2	similar to kine...	Canis lupus fam...
EAW63486	97.1	kinesin family ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014606	2.2e-30	47.2	KIAA0706
AB040881	3.5e-30	48.3	KIAA1448
D26361	5.6e-30	36.8	KIAA0042
AB046810	5.8e-30	39.2	KIAA1590
AB011163	1.4e-29	40.8	KIAA0591

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001752	103	124	PR00380	Kinesin
	IPR001752	222	239	PR00380	Kinesin
	IPR001752	257	275	PR00380	Kinesin
	IPR001752	312	333	PR00380	Kinesin
HMMPfam	IPR001752	20	363	PF00225	Kinesin
	IPR000253	480	544	PF00498	Forkhead-associated
	IPR000938	1712	1777	PF01302	CAP-Gly
HMMSmart	IPR001752	12	370	SM00129	Kinesin
ProfileScan	IPR001752	11	287	PS50067	Kinesin
ProfileScan	IPR000938	1730	1772	PS50245	CAP-Gly
ScanRegExp	IPR001752	256	267	PS00411	Kinesin
ScanRegExp	IPR000938	1730	1761	PS00845	CAP-Gly

Primer_f	TTCCTGCCCAAGATACTGACC
Primer_r	CGAATCCACACATAGAGAAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTCCTGCCCAAGATACTGACC
Primer_r	CGAATCCACACATAGAGAAGC
PCR product length	135 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles