KIAA1342

Product ID	ORK00217
Accession No	AB037763
Description	synaptotagmin IV
Clone name	fj00418
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3910 bp) Predicted protein sequence (426 aa)
HaloTag ORF Clone	FHC00217
Flexi ORF Clone	FXC00217
Source	Human fetal brain
Rouge ID	mKIAA1342 by Kazusa Mouse cDNA Project

Length: 3910 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2446 bp
Genome contig ID	gi51511735r_39001857
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GTTTGTAAGACATGAATAAATTGCTGCTTTTGCCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCCGTTTCAATGCAGACTTTCTGCCAATGGACTCTGTAATAAGGCTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	r	39101857	39111430	4	99.3	Perfect prediction

Length: 426 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9H2B2	6.7e-181	100.0	Synaptotagmin-4...	Homo sapiens
XP_523915	6.8e-181	100.0	synaptotagmin I...	Pan troglodytes
CAH93459	3.2e-180	99.5	hypothetical pr...	Pongo abelii
BAF83843	1.1e-179	99.5	unnamed protein...	Homo sapiens
XP_001083607	1.5e-179	98.8	synaptotagmin I...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D38522	1.3e-73	53.0	KIAA0080
AB037848	9.6e-16	26.1	KIAA1427
AB023202	3.9e-11	29.5	KIAA0985
AB011110	4.7e-08	29.0	KIAA0538
AB018277	7.1e-05	33.1	KIAA0734

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001565	158	173	PR00399	Synaptotagmin
	IPR001565	173	186	PR00399	Synaptotagmin
	IPR000008	187	199	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	214	227	PR00360	C2 calcium-dependent membrane targeting
	IPR001565	230	245	PR00399	Synaptotagmin
	IPR001565	250	260	PR00399	Synaptotagmin
HMMPfam	IPR000008	171	259	PF00168	C2 calcium-dependent membrane targeting
HMMPfam	IPR000008	305	393	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	170	274	SM00239	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	304	418	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000008	171	259	PS50004	C2 calcium-dependent membrane targeting
ProfileScan	IPR000008	303	393	PS50004	C2 calcium-dependent membrane targeting

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	16	PTVVGIFSAFGLVFTVSLFAWIC	38	PRIMARY	23

Primer_f	TGAACTGTAGTAGGTGTGTAG
Primer_r	CTGCTACCACCATTAACTTCT
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-