KIAA0475

Product ID	ORK00545
Accession No	AB007944
Description	family with sequence similarity 20, member B
Clone name	hh00451
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5983 bp) Predicted protein sequence (438 aa)
HaloTag ORF Clone	FHC00545
Flexi ORF Clone	FXC00545
Source	Human adult brain
Rouge ID	mKIAA0475 by Kazusa Mouse cDNA Project

Length: 5983 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	4417 bp
Genome contig ID	gi89161185f_177179470
PolyA signal sequence (AATAAA,-7)	+--------+--------+----*----+---- CTGAAAAAAGAAAATGAATAAAGATTTTAATAAAT
Flanking genome sequence (132852 - 132901)	----+--------+--------+--------+--------+----* ATTGATATCTGATCTTTTCCTCTTCTTTCCCCCTTCAGGATATTTCCAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	177261654	177312320	8	99.2	Perfect prediction

Length: 438 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O75063	1.7e-185	100.0	Protein FAM20B;...	Homo sapiens
XP_514027	3.8e-184	99.0	family with seq...	Pan troglodytes
XP_001115532	2.6e-183	98.8	family with seq...	Macaca mulatta
Q8VCS3	5.7e-182	97.3	Protein FAM20B;...	Mus musculus
XP_537175	9.3e-182	97.8	similar to Prot...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009581	204	431	PF06702	Protein of unknown function DUF1193

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	35	RVVLLAILLVIFIFTKVFLIDNL	57	PRIMARY	23

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	GeneBridge 4
Primer_f	ATCAAAAGAGAGGGTAGTGGC
Primer_r	GGTGAAACTGGGAACAACTAC
PCR product length	81 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles