KIAA0235

Product ID	ORK00471
Accession No	D87078
Description	pumilio RNA-binding family member 2, transcript variant 1
Clone name	ha04677s1
Vector information	The cDNA fragment was originally inserted at the EcoRV-NotI ... The cDNA fragment was originally inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) without using any linker or adapter and a RT-PCR product (1-1938) was subcloned upstream of the cDNA (1939-6040). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CGGTATCGAT AAGCTGGCCG CGAATTCACT AGTGATT-5' end of cDNA.
cDNA sequence	DNA sequence (6040 bp) Predicted protein sequence (1064 aa)
HaloTag ORF Clone	FHC00471
Flexi ORF Clone	FXC00471
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0235 by Kazusa Mouse cDNA Project
Note	We replaced ha04677, former representative clones for KIAA0235 with ha04677s1. (2002/5/10)

Length: 6040 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	2845 bp
Genome contig ID	gi89161199r_20211982
PolyA signal sequence (AATGAA,-33)	+--------+--------+----*----+---- AAAATGAAAAATGTGTGAATAACATTGTATGAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACCTGGTCTTGTGTTTTTCTCTAGATAAAATACCCCTCTGTACCTCAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	20311982	20390602	20	99.5	Perfect prediction

Length: 1064 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8TB72	99.8	Pumilio homolog...	Homo sapiens
XP_001140509	99.8	pumilio homolog...	Pan troglodytes
XP_001095741	99.4	similar to pumi...	Macaca mulatta
XP_001095854	99.4	similar to pumi...	Macaca mulatta
XP_849088	98.5	similar to pumi...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D43951	5.1e-93	76.6	KIAA0099

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001313	726	760	PF00806	Pumilio/Puf RNA-binding
	IPR001313	762	796	PF00806	Pumilio/Puf RNA-binding
	IPR001313	798	832	PF00806	Pumilio/Puf RNA-binding
	IPR001313	834	868	PF00806	Pumilio/Puf RNA-binding
	IPR001313	870	904	PF00806	Pumilio/Puf RNA-binding
	IPR001313	906	940	PF00806	Pumilio/Puf RNA-binding
	IPR001313	942	976	PF00806	Pumilio/Puf RNA-binding
	IPR001313	985	1019	PF00806	Pumilio/Puf RNA-binding
HMMSmart	IPR001313	726	761	SM00025	Pumilio/Puf RNA-binding
	IPR001313	762	797	SM00025	Pumilio/Puf RNA-binding
	IPR001313	798	833	SM00025	Pumilio/Puf RNA-binding
	IPR001313	834	869	SM00025	Pumilio/Puf RNA-binding
	IPR001313	870	905	SM00025	Pumilio/Puf RNA-binding
	IPR001313	906	941	SM00025	Pumilio/Puf RNA-binding
	IPR001313	942	977	SM00025	Pumilio/Puf RNA-binding
	IPR001313	985	1020	SM00025	Pumilio/Puf RNA-binding
ProfileScan	IPR001313	706	1046	PS50303	Pumilio/Puf RNA-binding
	IPR001313	726	761	PS50302	Pumilio/Puf RNA-binding
	IPR001313	762	797	PS50302	Pumilio/Puf RNA-binding
	IPR001313	798	833	PS50302	Pumilio/Puf RNA-binding
	IPR001313	834	869	PS50302	Pumilio/Puf RNA-binding
	IPR001313	870	905	PS50302	Pumilio/Puf RNA-binding
	IPR001313	906	941	PS50302	Pumilio/Puf RNA-binding
	IPR001313	942	977	PS50302	Pumilio/Puf RNA-binding
	IPR001313	978	1020	PS50302	Pumilio/Puf RNA-binding

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TTCATCCTTGCCCTCTGTTGG
Primer_r	TATTGGGAAGATTGGGTTGTC
PCR product length	152 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles