ROUGE

Gene/Protein Characteristic Table for mKIAA4253

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122417
Description :
Clone Name :	mbg07839 [Vector Info]
Source :	Mouse brain
Note :	The gene name of mbg07839 was changed from mKIAA1006 to mKIAA4253, because this gene is not a mouse ortholog of KIAA1006

Features of the cloned DNA sequence	Description

Length: 6145 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5358 bp

Genome contig ID gi65524842r_9528355
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
TGGGCAAAATAAAATACTCTAATCTCTTCTGAAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAGAAGCCCTCTTTTTGGAAATTTGTTTTAATGTTTTTCTGAGTTG

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 2..784
Length: 261 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB31853	2e-107	100.0	unnamed protein...	Mus musculus
AAM61881	3.9e-107	100.0	b-tomosyn [Mus ...	Mus musculus
NP_001074813	4.5e-107	100.0	syntaxin bindin...	Mus musculus
EDL03530	4.5e-107	100.0	mCG116242 [Mus ...	Mus musculus
Q8K400	4.6e-107	100.0	Syntaxin-bindin...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	5358 bp
Genome contig ID	gi65524842r_9528355
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- TGGGCAAAATAAAATACTCTAATCTCTTCTGAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAGAAGCCCTCTTTTTGGAAATTTGTTTTAATGTTTTTCTGAGTTG

Gene/Protein Characteristic Table for mKIAA4253

Features of the cloned DNA sequence

Features of the protein sequence