ROUGE

Gene/Protein Characteristic Table for mKIAA4251

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172947
Description :
Clone Name :	mfj01022 [Vector Info]
Source :	Mouse fetal brain
Note :	The gene name of mfj01022 was changed from mKIAA0420 to mKIAA4251, because this gene is not a mouse ortholog of KIAA0420

Features of the cloned DNA sequence	Description

Length: 4250 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2357 bp

Genome contig ID gi65527427f_116862798
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TTTTTTATTGTTACAATAATAAATGTGAACTGTTT
Flanking genome sequence
(117561 - 117610)
----+----*----+----*----+----*----+----*----+----*
AAGAAGAGTGTCCTTTTCTTCTTGGGAGGCCCCAAGGAAGAATAGAGATT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 1..1890
Length: 630 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAP19075	100.0	SEC14-like 1 (S...	Mus musculus
CAM23860	100.0	SEC14-like 1 (S...	Mus musculus
AAH05766	100.0	Sec14l1 protein...	Mus musculus
EDL34614	100.0	SEC14-like 1 (S...	Mus musculus
BAB23589	99.8	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
BC005759	8.7e-31	32.5	mKIAA1186

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006797 1 88 PF04707 MSF1

IPR008273 161 228 PF03765 Cellular retinaldehyde-binding/triple function

IPR001251 243 431 PF00650 Cellular retinaldehyde-binding/triple function

HMMSmart IPR001251 234 407 SM00516 Cellular retinaldehyde-binding/triple function

ProfileScan IPR001251 234 410 PS50191 Cellular retinaldehyde-binding/triple function

NULL 598 629 PS50324 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006797	1	88	PF04707	MSF1
IPR008273	161	228	PF03765	Cellular retinaldehyde-binding/triple function
IPR001251	243	431	PF00650	Cellular retinaldehyde-binding/triple function
HMMSmart	IPR001251	234	407	SM00516	Cellular retinaldehyde-binding/triple function
ProfileScan	IPR001251	234	410	PS50191	Cellular retinaldehyde-binding/triple function
NULL	598	629	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2357 bp
Genome contig ID	gi65527427f_116862798
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TTTTTTATTGTTACAATAATAAATGTGAACTGTTT
Flanking genome sequence (117561 - 117610)	----+--------+--------+--------+--------+----* AAGAAGAGTGTCCTTTTCTTCTTGGGAGGCCCCAAGGAAGAATAGAGATT

Gene/Protein Characteristic Table for mKIAA4251

Features of the cloned DNA sequence

Features of the protein sequence