| ROUGE |
Gene/Protein Characteristic Table for mKIAA4197 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK220540 |
|---|---|
| Sodium channel 25. | |
| mfj18089 [Vector Info] | |
| Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4063 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3326 bp Genome contig ID gi66880554r_66235484 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TGTTAATAGAGTCTAAAATAAAAGTCGCTAAAATTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAACTTATGTTGTGTTTATTTTGTGCCCCAGTGAGAATAGCACTTTTTTT
Features of the protein sequence |
Description | |
Coding region: 3..734
Length: 244 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |