ROUGE

Gene/Protein Characteristic Table for mKIAA4197

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220540
Description :	Sodium channel 25.
Clone Name :	mfj18089 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4063 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3326 bp

Genome contig ID gi66880554r_66235484
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TGTTAATAGAGTCTAAAATAAAAGTCGCTAAAATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACTTATGTTGTGTTTATTTTGTGCCCCAGTGAGAATAGCACTTTTTTT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 3..734
Length: 244 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAA67106	3.2e-93	100.0	sodium channel 25.	Mus musculus
AAI58049	1.5e-92	100.0	Scn9a protein [...	Mus musculus
CAM23211	1.5e-92	100.0	sodium channel ...	Mus musculus
NP_061340	1.5e-92	100.0	sodium channel,...	Mus musculus
AAI72147	1.5e-92	100.0	Scn9a protein [...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000048 148 168 PF00612 IQ calmodulin-binding region

HMMSmart IPR000048 146 168 SM00015 IQ calmodulin-binding region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 2 24 IIISFLVVVNMYIAVILENFSVA

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000048	148	168	PF00612	IQ calmodulin-binding region
HMMSmart	IPR000048	146	168	SM00015	IQ calmodulin-binding region

Method	From	To	amino acid sequence
SOSUI	2	24	IIISFLVVVNMYIAVILENFSVA

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3326 bp
Genome contig ID	gi66880554r_66235484
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TGTTAATAGAGTCTAAAATAAAAGTCGCTAAAATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTTATGTTGTGTTTATTTTGTGCCCCAGTGAGAATAGCACTTTTTTT

Gene/Protein Characteristic Table for mKIAA4197

Features of the cloned DNA sequence

Features of the protein sequence