| ROUGE |
Gene/Protein Characteristic Table for mKIAA4147 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK220232 |
|---|---|
| F-box/LRR-repeat protein 2-like. | |
| mni01012 [Vector Info] | |
| Source : | Mouse NKT cells |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 2409 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 886 bp Genome contig ID gi65527427r_97809805 PolyA signal sequence
(AATAAA,-20)
TTTAAAAGAAACATCAATAAATATTTTTTTAATCTFlanking genome sequence
(99988 - 99939)
AACTTTTACCATCAGGGGACCCTGCCTGAATCTTTGCCAGTCTGGAAAGA
Features of the protein sequence |
Description | |
Coding region: 3..1520
Length: 506 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR001810 | 95 | 140 | PF00646 | Cyclin-like F-box |
| HMMSmart | IPR001810 | 98 | 138 | SM00256 | Cyclin-like F-box |
| IPR006553 | 160 | 185 | SM00367 | Leucine-rich repeat | |
| IPR006553 | 186 | 211 | SM00367 | Leucine-rich repeat | |
| IPR006553 | 212 | 237 | SM00367 | Leucine-rich repeat | |
| IPR006553 | 238 | 263 | SM00367 | Leucine-rich repeat | |
| IPR006553 | 264 | 289 | SM00367 | Leucine-rich repeat | |
| IPR006553 | 290 | 315 | SM00367 | Leucine-rich repeat | |
| IPR006553 | 316 | 341 | SM00367 | Leucine-rich repeat | |
| IPR006553 | 342 | 367 | SM00367 | Leucine-rich repeat | |
| IPR006553 | 368 | 393 | SM00367 | Leucine-rich repeat | |
| IPR006553 | 394 | 419 | SM00367 | Leucine-rich repeat | |
| IPR006553 | 423 | 447 | SM00367 | Leucine-rich repeat | |
| IPR006553 | 448 | 473 | SM00367 | Leucine-rich repeat | |
| ProfileScan | IPR000694 | 37 | 70 | PS50099 | Proline-rich region |
| IPR001810 | 92 | 138 | PS50181 | Cyclin-like F-box | |
| IPR007089 | 142 | 220 | PS50501 | Leucine-rich repeat | |
| IPR007089 | 221 | 298 | PS50501 | Leucine-rich repeat | |
| IPR007089 | 325 | 402 | PS50501 | Leucine-rich repeat | |
| IPR007089 | 403 | 482 | PS50501 | Leucine-rich repeat |
| Method | From | To | amino acid sequence |
|---|---|---|---|
| - | - | - | - |
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
