ROUGE |
Gene/Protein Characteristic Table for mKIAA4147 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220232 |
---|---|
F-box/LRR-repeat protein 2-like. | |
mni01012 [Vector Info] | |
Source : | Mouse NKT cells |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2409 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 886 bp Genome contig ID gi65527427r_97809805 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
TTTAAAAGAAACATCAATAAATATTTTTTTAATCTFlanking genome sequence
(99988 - 99939) ----+----*----+----*----+----*----+----*----+----*
AACTTTTACCATCAGGGGACCCTGCCTGAATCTTTGCCAGTCTGGAAAGA
Features of the protein sequence |
Description | |
Coding region: 3..1520
Length: 506 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |