ROUGE |
Gene/Protein Characteristic Table for mKIAA4146 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220231 |
---|---|
msj06308 [Vector Info] | |
Source : | Mouse adult spleen |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2345 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 493 bp Genome contig ID gi65524842f_127831503 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
GAGTATTTTGTGTTCAAATAAACTTTAATTACATGFlanking genome sequence
(115256 - 115305) ----+----*----+----*----+----*----+----*----+----*
AATTATAATTTTTATTTTATATTTTGCTAAATTTAGTCGTTCTCTTTCTC
Features of the protein sequence |
Description | |
Coding region: 2..1849
Length: 616 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002110 | 533 | 545 | PR01415 | Ankyrin |
IPR002110 | 545 | 557 | PR01415 | Ankyrin | |
HMMPfam | IPR007043 | 191 | 477 | PF04960 | Glutaminase |
IPR002110 | 532 | 565 | PF00023 | Ankyrin | |
IPR002110 | 566 | 599 | PF00023 | Ankyrin | |
HMMSmart | IPR002110 | 532 | 562 | SM00248 | Ankyrin |
IPR002110 | 566 | 595 | SM00248 | Ankyrin | |
ProfileScan | IPR002110 | 504 | 586 | PS50297 | Ankyrin |
IPR002110 | 532 | 554 | PS50088 | Ankyrin |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |