Gene/Protein Characteristic Table for mKIAA4146

Length: 2345 bp

Restriction map

Length of 3'UTR	493 bp
Genome contig ID	gi65524842f_127831503
PolyA signal sequence (AATAAA,-19)	+----*----+----*----+----*----+---- GAGTATTTTGTGTTCAAATAAACTTTAATTACATG
Flanking genome sequence (115256 - 115305)	----+----*----+----*----+----*----+----*----+----* AATTATAATTTTTATTTTATATTTTGCTAAATTTAGTCGTTCTCTTTCTC

Coding region: 2..1849

Length: 616 aa

Entry Exp ID% Protein Source AAH89776 0 97.9 Gls2 protein [R... Rattus norvegicus Q571F8 0 100.0 Glutaminase liv... Mus musculus AAI41116 0 99.8 Glutaminase 2 (... Mus musculus BAE38445 0 99.8 unnamed protein... Mus musculus P28492 0 98.2 Glutaminase liv... Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK173039 4.8e-117 63.7 mKIAA0838 AK129094 6.9e-05 31.0 mKIAA0229

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	533	545	PR01415	Ankyrin
	IPR002110	545	557	PR01415	Ankyrin
HMMPfam	IPR007043	191	477	PF04960	Glutaminase
	IPR002110	532	565	PF00023	Ankyrin
	IPR002110	566	599	PF00023	Ankyrin
HMMSmart	IPR002110	532	562	SM00248	Ankyrin
	IPR002110	566	595	SM00248	Ankyrin
ProfileScan	IPR002110	504	586	PS50297	Ankyrin
	IPR002110	532	554	PS50088	Ankyrin

Method	From	To	amino acid sequence
-	-	-	-