ROUGE

Gene/Protein Characteristic Table for mKIAA4138

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220503
Description :
Clone Name :	mbg16412 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5154 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3484 bp

Genome contig ID gi65515060r_122504861
PolyA signal sequence
(AATAAA,-11)
+----*----+----*----+----*----+----
CAGTGTACTTACATAAAGCAAATAAATAAATCTTT
Flanking genome sequence
(99822 - 99773)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAACAACAACAACCAAGGTGGCCAGGCGGTGGTGGCGT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 366..1667
Length: 434 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8BNN1	1.3e-155	99.8	Spermatogenesis...	Mus musculus
EDL92798	1.5e-150	96.7	similar to RIKE...	Rattus norvegicus
Q8IUW3	2.3e-131	85.2	Spermatogenesis...	Homo sapiens
XP_001142436	9.5e-131	85.0	similar to Chro...	Pan troglodytes
XP_001092456	1.3e-129	84.3	similar to sper...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3484 bp
Genome contig ID	gi65515060r_122504861
PolyA signal sequence (AATAAA,-11)	+--------+--------+----*----+---- CAGTGTACTTACATAAAGCAAATAAATAAATCTTT
Flanking genome sequence (99822 - 99773)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAACAACAACAACCAAGGTGGCCAGGCGGTGGTGGCGT

Gene/Protein Characteristic Table for mKIAA4138

Features of the cloned DNA sequence

Features of the protein sequence