ROUGE

Gene/Protein Characteristic Table for mKIAA4135

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220185
Description :
Clone Name :	mpf00123 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 6209 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3760 bp

Genome contig ID gi66880665f_80134679
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
GCAGCAAGAAATTAATTAAATTTGTACATACCATG
Flanking genome sequence
(160294 - 160343)
----+----*----+----*----+----*----+----*----+----*
TCTCTTAGATTTCTGTGTATGTTGTGAAGGACATTATTTTGAGAAGAAAT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 278..2446
Length: 723 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q571K4	4.9e-198	100.0	Mitogen-activat...	Mus musculus
XP_001055511	4.6e-193	97.3	similar to TAK1...	Rattus norvegicus
XP_548926	1.9e-188	94.8	similar to TAK1...	Canis lupus fam...
XP_001488650	2.5e-188	94.6	similar to Mito...	Equus caballus
Q8N5C8	3.6e-187	94.8	Mitogen-activat...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AB093262	2.6e-09	38.8	mKIAA0733

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003892 15 57 PF02845 Ubiquitin system component Cue

IPR001876 693 723 PF00641 Zinc finger

HMMSmart IPR003892 15 57 SM00546 Ubiquitin system component Cue

IPR001876 696 720 SM00547 Zinc finger

ProfileScan IPR000694 159 462 PS50099 Proline-rich region

NULL 241 322 PS50322 NULL

IPR001876 693 723 PS50199 Zinc finger

ScanRegExp IPR001876 698 717 PS01358 Zinc finger

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003892	15	57	PF02845	Ubiquitin system component Cue
IPR001876	693	723	PF00641	Zinc finger
HMMSmart	IPR003892	15	57	SM00546	Ubiquitin system component Cue
IPR001876	696	720	SM00547	Zinc finger
ProfileScan	IPR000694	159	462	PS50099	Proline-rich region
NULL	241	322	PS50322	NULL
IPR001876	693	723	PS50199	Zinc finger
ScanRegExp	IPR001876	698	717	PS01358	Zinc finger

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3760 bp
Genome contig ID	gi66880665f_80134679
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- GCAGCAAGAAATTAATTAAATTTGTACATACCATG
Flanking genome sequence (160294 - 160343)	----+--------+--------+--------+--------+----* TCTCTTAGATTTCTGTGTATGTTGTGAAGGACATTATTTTGAGAAGAAAT

Gene/Protein Characteristic Table for mKIAA4135

Features of the cloned DNA sequence

Features of the protein sequence