ROUGE |
Gene/Protein Characteristic Table for mKIAA4110 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220289 |
---|---|
PERQ amino acid rich with GYF domain protein 1. | |
mid06095 [Vector Info] | |
Source : | Mouse adult pancreatic islet |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2633 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 417 bp Genome contig ID gi65498774f_136371750 PolyA signal sequence
(GATAAA,-34) +----*----+----*----+----*----+----
AGATAAAAAAAATAATGAAAAAAAAAGTTAGGCTGFlanking genome sequence
(105240 - 105289) ----+----*----+----*----+----*----+----*----+----*
AAAGGAAAAAAAAAATCACACTGTTATTTTTGGCCAGTGGGTACCAGGCC
Features of the protein sequence |
Description | |
Coding region: 3..2213
Length: 737 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |