ROUGE |
Gene/Protein Characteristic Table for mKIAA4105 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220181 |
---|---|
glycosyltransferase-like 1B. glycoslytransferase-like 1B. |
|
mpm08180 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4879 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 737 bp Genome contig ID gi66880554r_91969744 PolyA signal sequence
(AATAAA,-28) +----*----+----*----+----*----+----
CTTATATAATAAAATTTTTCAATTTTTTTTATCTTFlanking genome sequence
(99987 - 99938) ----+----*----+----*----+----*----+----*----+----*
ATGTGTGAGTGTTTTGTCTGTATGTATGTGGCAAGACGGCTTTAGATCCC
Features of the protein sequence |
Description | |
Coding region: 3393..4139
Length: 249 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |